| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
* Dipartimento di Scienze e Tecnologie Veterinarie per la Sicurezza Alimentare, Università degli Studi di Milano, Via Trentacoste 2, Milano 20134 Italy
Dipartimento di Scienze Biomediche e Biotecnologie, Università degli Studi di Brescia, Viale Europa 11, Brescia 25123 Italy
Istituto di Tecnologie Biomediche, Consiglio Nazionale delle Ricerche, Via Fratelli Cervi 93, Segrate 20090 Italy
Istituto di Biologia e Biotecnologia Agraria, Consiglio Nazionale delle Ricerche, Via Bassini 15, Milano 20133 Italy
1 Corresponding author: stefania.chessa{at}unimi.it
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGEMENTSREFERENCES |
|---|
S1-casein, ß-casein, 
-casein, and ß-lactoglobulin genes were considered because of their well-known effects on milk composition and cheese production. A total of 22 polymorphic sites, corresponding to 21 different variants, were included in the diagnostic microarray. First, a multiplex PCR was developed to amplify all the DNA target sequences simultaneously. Second, the LDR-UA assay was implemented. The method was validated by analyzing 100 Italian Friesian DNA samples, which were also genotyped by conventional methods both at the protein level by means of milk isoelectrofocusing and at the molecular level using PCR-RFLP and PCR-single strand conformation polymorphism techniques. The genotypes obtained using the LDR-UA approach were in full agreement with those obtained by the conventional analyses. An important result of the LDR-UA assay was a more accurate genotyping of the different milk protein alleles than was found with conventional typing methods. At the -casein gene, in fact, 4 samples were heterozygous (3 reference samples and 1 validation sample) for an allele coding for Thr136 and Ala148. This variant, which can be considered as the wild type of the genus Bos, is not usually identifiable by the conventional typing methods used. The multiplex PCR-LDR-UA approach developed provides for an accurate, inexpensive, and high-throughput assay that does not exhibit false positive or false negative signals, thus making it highly suitable for animal genotyping.
Key Words: milk protein gene • cattle • microarray
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGEMENTSREFERENCES |
|---|
-LA and ß-LG, and 4 for the CN, S1-CN, S2-CN, ß-CN, and -CN (CSN1S1, CSN1S2, CSN2, and CSN3, respectively). The 4 CN genes are tightly linked in a 250-kb cluster (Ferretti et al., 1990; Threadgill and Womack, 1990) on chromosome 6 (Hayes et al., 1993; Popescu et al., 1996). A recent revision of milk protein nomenclature considering only protein polymorphisms (Farrell et al., 2004) includes 8 S1-CN, 4 S2-CN, 12 ß-CN, 11 -CN, 11 ß-LG, and 3 -LA variants within the genus Bos. In addition to the effects of milk protein variants on milk composition and cheese-making properties (reviewed by Grosclaude, 1988; Di Stasio and Mariani, 2000; Martin et al., 2002), statistically significant associations with several milk production traits have also been identified for sites of polymorphism within noncoding regions in the CN complex (for a review see Martin et al., 2002). This is the case of a polymorphism within the short interspersed nucleotide element Bov-A2 in the second intron of CSN3 described by Damiani et al. (2000b) and of the polymorphisms of the CSN1S1 promoter described by Prinzenberg et al. (2003). Thus, the CN cluster polymorphism has to be considered as a whole complex in which expression sequence polymorphisms could help explain the productive implications of the different CN loci and the results obtained from the detection of CN gene effects on productive traits at the haplotype level (Braunschweig et al., 2000; Ikonen et al., 2001; Boettcher et al., 2004).
The importance of going deeper into the knowledge on milk protein polymorphisms in cattle is therefore evident. The availability of a fast method that allows the simultaneous typing of a great number of mutations affecting milk protein structure and composition could help researchers as well as breeding associations to identify the genetic milk protein variations.
Microarray technology offers the potential of opening new doors in the study of genome complexity, thanks to the extreme degree of parallelization (Ramsay, 1998). Arrays can be used to study DNA, with the primary aim being the identification and the genotyping of genetic polymorphisms. Hybridization and hybridization plus enzymatic processing are the 2 diverse approaches currently available to discriminate among different alleles when using microarray technology (Hacia, 1999; Kurg et al., 2000; Pastinen et al., 2000). As an example applied to animal characterization, an oligonucleotide microarray based on the arrayed primer extension technique was recently described, allowing genotyping in genes of interest for bovine milk protein biosynthesis (Kaminski et al., 2005).
A different approach, based on a ligation detection reaction (LDR) combined with a universal array (UA), could be considered. This technique allows for the unequivocal detection of several amplicons in a single experiment (Consolandi et al., 2004). The procedure is based on the discriminative properties of DNA ligase and requires the design of 2 adjacent oligonucleotide probes for each target sequence. One probe, named the "single nucleotide polymorphism (SNP)-specific discriminating" probe, is 5'-fluorescently labeled, whereas the other, named the "common" probe, contains a unique, artificial 3'-sequence (cZipCode) that is complementary to a "ZipCode" sequence within the UA. As first described by Gerry and coworkers (1999), the UA consists of selected oligonucleotides with similar hybridization characteristics and minimal cross-hybridization. This kind of array is termed "universal" because sequences complementary to the immobilized probes could be appended to any set of specific common probes during target-DNA processing. These ZipCodes or "tag" oligonucleotides can be used to anchor their complementary sequences to a precise array location.
Here we applied this approach to the detection of 22 polymorphic sites (corresponding to 21 different variants) in bovine milk protein genes. A multiplex PCR (mPCR) was also developed to amplify the DNA fragments containing these polymorphisms at the same time, with the aim of making a diagnostic genotyping assay available for the simultaneous detection of different polymorphisms in the milk protein genes.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGEMENTSREFERENCES |
|---|
. The conventional analyses also include the typing method for the CSN1S1 promoter polymorphisms developed in the present work, described hereafter. The samples were chosen on the basis of milk protein variability in Holstein-Friesian cattle. The following alleles were therefore considered: CSN1S1*B, CSN1S1*C, CSN2*A1, CSN2*A2, CSN2*A3, CSN2*B, CSN2*C, CSN2*I, CSN3*A, CSN3*B, CSN3*C, CSN3*E, CSN3*H, LGB*A, LGB*B, each one resulting in a corresponding protein variant named by the same letter (Farrell et al., 2004). All these variants were identified in the Holstein-Friesian, except for CSN3*C and CSN3*H. The first one was found in other taurine breeds, including the Brown Swiss (Formaggioni et al., 1999). The latter was included in the microarray as a marker of Bos indicus introgression (Jann et al., 2004). Moreover, the polymorphism within the CSN3 intron II Bov-A2 element (Damiani et al., 2000b) and the CSN1S1 promoter mutations (Prinzenberg et al., 2003) were integrated into the diagnostic chip as indicators of the genetic variability in the noncoding regions of milk protein genes. Table 2 shows the genotypes of the DNA reference samples, which are discussed further in the Results section.
|
|
For the SSCP analysis, 6 µL of PCR product was added to 8 µL of denaturation solution (0.05% of xylenecyanol, 0.05% of bromophenol blue, 0.02 M EDTA in deionized formamide). After heat denaturation at 95°C for 8 min, the samples were immediately chilled on ice and then run overnight with a Penguin Dual Gel Water-Cooled Electrophoresis System (OWL Scientific Inc., Woburn, MA) on 10% acrylamide:bisacrylamide gels (33:1) with 0.5% glycerol in 0.5x Trisborate-EDTA buffer at 280 V and 5°C for 16 h. Bands were visualized by silver staining (Bassam et al., 1991).
The method was applied to the 25 reference DNA samples. Among the samples showing different migration patterns, 8 were randomly chosen for sequencing. Primers used for sequencing were the same as those used for the PCR-SSCP techniques. The PCR products were sequenced by Primm srl (Milano, Italy). The nucleotide sequences were analyzed with Bioedit software (Hall, 1999).
Validation Samples
A total of 100 milk samples of the Italian Friesian breed from 25 Northern Italy herdbook farms were collected for the validation analyses of the LDR-UA assay applied to animal genotyping. As a first step, all milk samples were typed by isoelectrofocusing (IEF; Erhardt et al., 1998). This analysis allows simultaneous screening of the main milk protein variants at the phenotype level, and it is a useful tool for checking milk protein gene expression.
A commercial kit (GFX Genomic Blood DNA Purification kit, Amersham Biosciences, Piscataway, NJ) was used for the DNA extraction directly from milk. The extraction was performed starting with 300 µL of fresh milk to recover at least 5 ng/µL of genomic DNA at a final volume of 100 µL.
To test the quality of the DNA extraction from milk, a PCR assay for the CSN2 fragments was performed using the specific primers described in Table 3 and the amplification protocol described above for the CSN1S1 promoter region PCR-SSCP method. Samples giving weak or no bands on a 2% agarose gel were amplified using a GenomiPhi DNA Amplification kit (Amersham Biosciences UK Limited, Buckinghamshire, UK) following the instructions provided by the manufacturer. All DNA validation samples were typed by the LDR-UA assay developed in the present work and by the conventional methods described in Table 1
.
|
. The amplification reaction was performed in a 50-µL mixture containing 15 µL of DNA solution (at least 75 ng), 1x AccuPrime PCR Buffer II, 1 µL of AccuPrime Taq DNA Polymerase (Invitrogen, Milano, Italy), 10 pmol of primers for CSN1S1 exon 17, LGB exon 3, Bov-A2 element, and CSN1S1 promoter, and 16 pmol of primers for CSN2 exon 6 and exon 7, CSN3 exon 4, and LGB exon 4. The following conditions were used for the PCR assay: an initial denaturation step of 94°C for 5 min was followed by 35 cycles of 94°C for 30 s, 56°C for 30 s, 68°C for 60 s, and a final extension step of 68°C for 7 min using a PTC-200 DNA engine thermal cycler (MJ Research Inc., Waltham, MA).
The DNA solution containing the PCR products was then purified by GFX PCR DNA and Gel Band Purification kits (Amersham Pharmacia Biotech Inc., Piscataway, NJ), eluted in 40 µL of autoclaved water and quantified using a Bioanalyzer 2100, and a DNA 7500 kit for 100- to 7,500-bp dsDNA sizing and quantification (Agilent Technologies, Milano, Italy).
LDR Probe Design
According to the LDR procedure described by Consolandi et al. (2004), we designed specific probes surrounding the polymorphic sites of interest listed in Table 4 to be used for allele identification. Two discriminating probes (allele-specific probes designed to have their 3' position placed just over the polymorphic site) and a common probe were selected for each SNP, except for the 2 deletions 395–396 and 397–400 of the CSN1S1 promoter, for which 2 common probes were designed (Table 5).
|
|
. When a probe sequence contained an ambiguity code, this base was replaced with degenerate bases (Table 5) during oligonucleotide synthesis. Oligonucleotide probes were purchased, HPLC-purified, and checked by matrix-assisted laser desorption ionization-mass spectrometry by Thermo-Hybaid GmbH (Ulm, Germany). The specificity of the probe sequences was checked in the GenBank database using BLAST to verify the absence of homology with other sequences. A ZipCode sequence (Consolandi et al., 2004) was randomly assigned to each polymorphic site, and the ZipCode complement sequence (cZipCode) was attached to the 3'-terminal position of the related common probe. All oligonucleotides had similar thermodynamic features and Tm values of 67 to 69°C.
The possibility of hairpin loop formation in the 24 common probes with cZipCode sequences was checked by using the Oligo Analyzer software available online (Integrated DNA Technologies Inc., 2006).
In addition, we designed a probe pair matching a synthetic template, 50 bp long, (5'-AGCCGCGAACAC CACGATCGACCGGCGCGCGCAGCTGCAGCTTGC TCATG-3'), used as a ligation control, and a sequence complementary to ZipCode 66 as a control for the hybridization reaction (5'-GTTACCGCTGGTGCTGCCG CCGGTA-3').
UA Preparation
To prepare a UA, ZipCode sequences were chosen from among those described in the literature (Gerry et al., 1999; Chen et al., 2000). The 5' amino-modified ZipCodes, carrying an additional poly(dA)10 tail at their 5' end, were dissolved in 100 mM phosphate buffer (pH 8.5) at a final concentration of 50 µM and spotted 4 times onto Codelink slides (Amersham Biosciences Europe GmbH, Milano, Italy) by a pin contact arrayer (Microgrid II Compact, BioRobotics, Cambridge, UK). Printed slides were processed according to the manufacturer’s protocol.
Batch quality control was performed by hybridization with 1 µM 5' Cy3-labeled poly(dT)10 in a solution containing 5x SSC and 0.1 mg/mL of salmon sperm DNA at room temperature for 1 h, then washing for 15 min in 2x SSC. The fluorescent signal was checked by laser scanning. By using 8 subarrays per slide, associated with a multichamber hybridization system, 8 samples were run in parallel on the same slide.
LDR and Hybridization onto UA
The LDR was performed in a final volume of 20 µL, containing 20 mM Tris-HCl (pH 7.5), 20 mM KCl, 10 mM MgCl2, 0.1% NP4O, 0.01 mM ATP, 1 mM dithiothreitol, 2 pmol of each discriminating oligo, 2 pmol of each common probe, and 5 to 50 fmol of purified PCR product. The reaction mixture underwent a denaturation step for 2 min at 94°C, and then 1 µL of 4 U/µL of Pfu DNA ligase (Stratagene, La Jolla, CA) was added. The LDR was carried out for 30 cycles of 94°C for 30 s and 65°C for 4 min in a GeneAmp PCR System 9700 (Applied Biosystems, Foster City, CA). The hybridization solution (65 µL), consisting of the ligation reaction mix, 10 pmol each of the Cy3- and Cy5-labeled hybridization control probes, 5x SSC, and 0.1 mg/mL of salmon sperm DNA was heated at 94°C for 2 min and applied onto the UA using a multisampling hybridization chamber (Press-to-Seal silicone isolator, Schleicher & Schuell, Dassel, Germany). The hybridization reaction was carried out in the dark at 65°C for 2 h, in a temperature-controlled oven. After removal of the chamber, the array was washed in prewarmed 1x SSC-0.1% SDS for 15 min at 65°C.
Signal Detection and Statistical Data Analysis
Fluorescent signals were measured with a ScanArray Lite laser scanning system and ScanArray Express Microarray Analysis System 2.1 software (PerkinElmer Life Sciences, Boston, MA) using the green laser for Cy3 dye (
ex 543 nm/em 570 nm) and the red laser for Cy5 dye (ex 633 nm/em 670 nm). Both the laser and the photomultiplier tube gain varied between fluorochromes and experiments. Spot analysis of 5-µm-resolution TIFF images was carried out by using the Scan-Array Express Microarray Analysis System software supplied with the scanner. The quantification method chosen was the "fixed circle." Spot intensities were calculated using the mean intensity option. Data analysis for each experiment was performed by using the following calculations:
Genotype Determination
To define the genotype for each SNP, we calculated the allelic fraction (AF), which estimates the relative amount of allele 1 (Cy3-labeled) with respect to allele 2 (Cy5-labeled) by using the following equation:
 |
as described by Liljedahl et al. (2003). The AF values of each SNP were plotted simultaneously to analyze their distribution as a function of the 3 possible genotypes (11, 12, and 22). A regression analysis of the AF values on the number of 2 alleles in the genotype was also performed. A specific program was developed in SAS software (SAS Institute, Inc., Cary, NC) to reconstruct the different alleles on the basis of the SNP analyzed (Table 4).
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGEMENTSREFERENCES |
|---|
Milk was chosen for the DNA extraction because it is particularly suitable for the routine genetic analyses that could be performed by means of the LDR-UA assay. In fact, milk is more suitable than blood or hair in dairy cattle, where a screening of milk protein loci in the female population could be carried out with the DNA chip developed. Considering that the DNA extracted from milk for validation analyses is sometimes qualitatively poor (20% of the samples), giving low or no product in the PCR quality test, a method was found to use this DNA. In fact, the whole genome amplification procedure described and applied to these samples gave an amount of DNA quantitatively and qualitatively sufficient to perform mPCR amplification (data not shown).
Development of the CSN1S1 Promoter SSCP Analysis
For the CSN1S1 promoter region, an SSCP analysis was developed as a fast and reliable alternative to the microarray analysis for typing this region and for testing a number of samples sufficient to find the references samples for all the alleles included in the microarray analysis. The SSCP analysis developed revealed 4 different allelic patterns. The sequencing confirmed that they corresponded to the 4 alleles described by Prinzenberg et al. (2003) and were named 1, 2, 3, and 4 according to the authors and the sequence analysis. The migration patterns of alleles 2 and 3 were quite similar (Figure 1), so in some cases it was necessary to sequence the samples to be sure of the genotype.
|
.
|
. With regard to the efficiency and the behavior of all the probes, the SNP determinations performed by the mPCR-LDR-UA approach were in agreement with genotyping carried out by protein IEF, conventional DNA molecular methods, and direct sequencing, except for some detection limits of IEF and PCR-SSCP, summarized in Table 6, showing the allele frequencies in the validation samples.
|
|
) and in the validation samples (Table 6), the occurrence of an allele (here named W) coding for Thr136 and Ala148. This allele was not detectable by either IEF or PCR-SSCP. In addition to CSN3*W and the polymorphisms in the noncoding sequences, IEF cannot detect CSN2*I comigrating with CSN2*A2, and CSN3*H comigrating with CSN3*A. The latter allele was not detected in the Italian Holstein samples analyzed. For the CSN1S1 promoter, the sometimes ambiguous discrimination of alleles 2 and 3 by PCR-SSCP ideally had to be confirmed by sequencing. This typing difficulty was overcome by using the DNA chip developed in this study.
The differences in performance of the entire process consisting of mPCR-LDR-UA were normalized by adjustments of the fluorescent signal intensity of each spot relative to the signal obtained from the IC, corresponding to a region of the CSN2 gene and associated with ZipCode 35. Because of our probe design strategy, this region was heterozygous in all the samples analyzed.
Afterward, the AF values of each SNP analyzed were plotted simultaneously as a function of the 3 possible genotypes, as shown in Figure 4. We obtained a very well-defined distribution corresponding to the 3 possible genotypes: AF ranging from 0.87 to 1.00 for the homozygotes for allele 1, from 0.01 to 0.21 for the homozygotes for allele 2, and 0.36 to 0.65 for heterozygotes. All the typed SNP fell within one of the 3 distinct non-overlapping areas, defining the 3 possible genotypes unequivocally. The regression analysis was highly significant (P < 0.0001, R2 = 0.998), indicating the particular robustness of the genotype classification of the basis of the AF values obtained.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGEMENTSREFERENCES |
|---|
Our approach provides for an accurate, inexpensive, and high-throughput assay that does not exhibit false positive or false negative signals, thus making it highly suitable for animal genotyping. All the LDR probes selected were designed to have high theoretical Tm to perform the ligation reaction at 65°C, which prevented problems caused by secondary structures of the target DNA. In the LDR, the specificity of the hybridization probes and the selectivity of the ligation reaction are combined to increase discrimination power. Furthermore, by means of the LDR it is possible to target several PCR amplicons at the same time in a single ligation reaction. The development of an mPCR reaction for the simultaneous amplification of 8 different fragments allows for increasing throughput and lowers time and costs. The good quality of the mPCR products, in terms of length and concentration, was taken as a guarantee of successful LDR.
The whole procedure, from DNA extraction to signal analysis, required almost 10 h for the typing of 24 samples. Because the number of animals assayed depends on how many arrays can be examined, we increased this number by means of "arrays of arrays." The use of 8 subarrays per slide format associated with a multi-chamber hybridization system allowed the simultaneous genotyping of 8 different samples at once, either homozygous or heterozygous for each SNP analyzed, at minimized reagent costs (Figure 3A).
As pioneered by Gerry et al. (1999) and Favis et al. (2000), our platform also allowed insertion and deletion polymorphisms to be genotyped. For the CSN1S1 promoter, this approach was applied by designing 2 common probes, differing at their 3'-nucleotide, to detect 2 deletions at the CNS1S1 promoter. An innovative result obtained in the present work was the successful use of 2 different fluorochromes for the deletion genotyping.
To test the feasibility of using LDR-UA as a genotyping assay to discriminate milk protein genes, a set of 100 animals was successfully analyzed. An important result of our LDR-UA genotyping was a more accurate genotyping of the different milk protein alleles. In the validation samples, new findings were obtained from the analysis of LGB and CSN3. For LGB, the G nucleotide at gene position 5,223 (Table 4) was never detected in the samples, suggesting that this synonymous SNP may be a sequencing mistake or a rare mutation not affecting the LGB typing.
The 2 main CSN3 alleles in Bos taurus and B. indicus are CSN3*A (Thr136-Asp148) and CSN3*B (Ile136-Ala148; Farrell et al., 2004). The LDR-UA genotyping allows the identification of both SNP associated with these main -CN variants, thus providing additional information on the intragenic CSN3 haplotype, which could not be evaluated by the other genotyping methods used. In fact, at CSN3 4 samples were found to be heterozygous for an allele coding for Thr136 and Ala148. This variant can be considered the wild type of the genus Bos, as first suggested by Addeo and Mercier (1977), who found the Italian water buffalo (Bubalus arnee) monomorphic for this intragenic haplotype, although until now, it has not been detected in B. taurus and B. indicus. In the most recent nomenclature of milk proteins, a variant identified in the yak (Bos grunniensis) coding for Thr136 and Ala148 was renamed as G2 (Farrell et al., 2004). This nomenclature includes milk protein variants from different Bos species, thus generating possible confusion from the phylogenetic point of view. The ancestral variant could usefully be defined as W (wild). Among the 4 samples in our work carrying this allele, 2 of the 2 BW were found in the Somba breed within the reference samples and the third was found in the Italian Friesian validation samples, whereas for the AW, one was found again within the Somba reference samples. Thus, the ancestral allele Thr136-Ala148 was found in the Italian Friesian sample analyzed at a low frequency (1/200 = 0.005), but its occurrence should be taken into account to have a more complete picture of the genetic variation at -CN as well as at the entire CN complex.
This finding in the Italian Friesian sample indicates the potential of our microarray-based assay to detect intragenic haplotypes not identifiable using conventional molecular techniques. This potential is of great interest for genetic analyses. The informative content of a locus is increased by the discovery of such haplotypes, providing additional elements for biodiversity studies and phylogenetic analyses.
In conclusion, we demonstrated the great potential of the mPCR-LDR-UA method for rapid and reliable identification of milk protein polymorphisms in cattle. The method is currently under Italian Patent (Castiglioni et al., 2006). The next step in our mPCR-LDR-UA approach applied to bovine milk protein polymorphisms will be to include further mutations in the microarray that are important for other breeds. For Italian Brown typing, for example, the CSN1S1*G allele needs to be considered for its important expression effect (Rando et al., 1998), as does the CSN1S1*F allele, which was found in the same breed within the haplotype CNS1S1*F-CSN2*A2-CSN3*B (Boettcher et al., 2004). Other important noncoding milk protein polymorphisms could also be added to the chip, such as LALBA (Bleck and Bremel, 1993), LGB (Wagner et al., 1994; Ehrmann et al., 1997; Lum et al., 1997; Kaminski and Zabolewicz, 2000; Kuss et al., 2003), and CN genes (Schild and Geldermann, 1996; Szymanowska et al., 2003; Szymanowska, et al., 2004). As described in Consolandi et al. (2004), up to 54 different discriminating probes can be used in such a multiplex ligation reaction without affecting the efficiency of the method. The full potential of microarrays implying a large set of analysis to be performed in parallel could be exploited in detecting several SNP at once.
This technology offers the power of a microarray format, facilitating the genotyping of different genomic regions, which could be investigated for phylogenetic and association studies, for the evaluation of genetic distances among cattle breeds and the domestication history of bovine species, and for dairy cattle identification and parentage control. In selection, the chip could also be used to analyze CN haplotypes instead of single loci, which would help to exploit the effects of the entire CN cluster on milk yield and component traits. Interrogation of known SNP, compared with the most popular DNA markers (microsatellites), is attractive because they are genetically stable and amenable to high throughput with automated technology. They are considered a realistic alternative in livestock identification, kinship analysis, and linkage studies. The mPCR-LDR-UA technology could become a powerful tool for their detection and exploitation in animal breeding.
|
ACKNOWLEDGEMENTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGEMENTSREFERENCES |
|---|
Received for publication April 12, 2006. Accepted for publication August 1, 2006.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGEMENTSREFERENCES |
|---|
-casein of buffalo. Biochimie 59:375–379.[Medline]-lactalbumin 5' flanking region. Gene 126:213–218.[Medline]-casein SINE Bov-A2 and CYP21-hydroxylase in some bovine breeds. Zoot. Nutriz. Anim. 3:145–148.-casein (CSN3) gene. Anim. Genet. 31:277–279.[Medline]S2-casein gene (CASA2) to the homoeologous cattle, sheep, and goat chromosomes 4 by in situ hybridization. Cytogenet. Cell Genet. 64:281–285.[Medline]S1-casein locus by the insertion of a relict of a long interspersed element. J. Dairy Sci. 81:1735–1742.[Abstract]s1, s2 and ß. Theor. Appl. Genet. 93:887–893.S1- and S2-casein genes on selected milk production traits in Polish Black-and-White cows. Anim. Sci. Pap. Rep. 21:97–108.This article has been cited by other articles:
|
|
 |
|
  A. M. Caroli, S. Chessa, and G. J. Erhardt Invited review: Milk protein polymorphisms in cattle: Effect on animal breeding and human nutrition J Dairy Sci, November 1, 2009; 92(11): 5335 - 5352. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Severgnini, P. Cremonesi, C. Consolandi, G. Caredda, G. De Bellis, and B. Castiglioni ORMA: a tool for identification of species-specific variations in 16S rRNA gene and oligonucleotides design Nucleic Acids Res., September 1, 2009; 37(16): e109 - e109. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Cremonesi, G. Pisoni, M. Severgnini, C. Consolandi, P. Moroni, M. Raschetti, and B. Castiglioni Pathogen detection in milk samples by ligation detection reaction-mediated universal array method J Dairy Sci, July 1, 2009; 92(7): 3027 - 3039. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Sotgia, M. C. Casimiro, G. Bonuccelli, M. Liu, D. Whitaker-Menezes, O. Er, K. M. Daumer, I. Mercier, A. K. Witkiewicz, C. Minetti, et al. Loss of Caveolin-3 Induces a Lactogenic Microenvironment that Is Protective Against Mammary Tumor Formation Am. J. Pathol., February 1, 2009; 174(2): 613 - 629. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
