|
|
||||||||
-Casein (CSN3) Polymorphism: New Developments in Molecular Knowledge
1 Institut für Tierzucht und Haustiergenetik, Justus-Liebig Universität, 35390 Gießen, Germany
2 Dipartimento di Scienze e Tecnologie Veterinarie per la Sicurezza Alimentare, Università degli Studi di Milano, 20134 Milan, Italy
3 Dipartimento di Sanità e Benessere Animale, Università di Bari, 70010 Valenzano, Italy
Corresponding author: Eva-Maria Prinzenberg; e-mail: eva-maria.prinzenberg{at}agrar.uni-giessen.de.
| ABSTRACT |
|---|
|
|
|---|
-casein (CSN3) locus in the domesticated goat (Capra hircus). In the present study, 2 new patterns previously identified by PCR-single-strand conformation polymorphism analysis (SSCP) were characterized. The allele provisionally named "X" (GenBank Accession no. AY350425) differs from CSN3*C (AF485341) by a (silent) A
G substitution at position 509 of the goat CSN3 reference sequence (X60763). As this newly identified sequence changes the amino acid sequence, and the already known CSN3*C allele (AF485341) has an additional silent mutation, we proposed a change in nomenclature to reflect these changes, indicating the silent mutation with the prime symbol (i.e.,'). The CSN3*M allele (provisionally named "Y") results in a new protein variant, differing by 2 nonsynonymous mutations from the CSN3*F allele. The new variant is characterized by a G
A transition at nucleotide position 384, resulting in the amino acid exchange Asp90
Asn90, and a C
T transition at position 550, resulting in a Val145
Ala145 substitution. Thus, the number of alleles identified in the domesticated goat has increased to 16, of which 13 are protein variants and 3 are silent mutations, involving a total of 15 polymorphic sites in CSN3 exon 4. Data on the distribution of the main alleles in 7 goat breeds of Europe, West Africa, and the Near East show differences in the occurrence and frequency of the alleles between breeds and geographic origin with the highest number of alleles found in goat breeds from the Near East.
Key Words: goat
-casein polymorphism single-strand conformation polymorphism nomenclature
Abbreviation key: CSN3 =
-casein gene, dsPCR = double-stranded PCR product, IEF = isoelectric focusing, IP = isoelectric point, SSCP = single-strand conformation polymorphism, ssPCR = single-stranded PCR product.
| INTRODUCTION |
|---|
|
|
|---|
s1-, ß-, and
s2-caseins, the
-casein fraction plays a crucial role in the formation, stabilization, and aggregation of the casein micelles and thus affects the technological (Mariani et al., 1976; Aleandri et al., 1990; Lodes et al., 1996; Falaki et al., 1997) and nutritional properties of milk (Mercier et al., 1973, 1976; Malkoski et al., 2001). Therefore, the
-casein gene (CSN3) is unlikely to be completely free of selective constraints (Ward et al., 1997). Interspecies comparisons have demonstrated that CSN3 possesses the highest degree of conservation among the casein genes, which may be related to its essential function as a stabilizer of casein micelles (Alexander et al., 1988). On the other hand, high intraspecies variability has been reported for CSN3 in cattle (for a review see Formaggioni et al., 1999) and, more recently, in goats.
Since the discovery of 2
-casein protein variants in goats (Di Luccia et al., 1990), successively confirmed at the protein and DNA level by Caroli et al. (2001), additional CSN3 polymorphisms have been identified by DNA analysis (Yahyaoui et al., 2001; Angiolillo et al., 2002; Yahyaoui et al., 2003; Jann et al., 2004), and different typing methods were developed (Yahyaoui et al., 2001; Chessa et al., 2003; Yahyaoui et al., 2003). A total of 13 polymorphic sites have been identified in the domesticated goat (Jann et al., 2004), allowing for the identification of 14 DNA variants corresponding to 11 protein variants, if one considers the variant first observed in Capra pyrenaica (Yahyaoui et al., 2001) and later in domesticated goat breeds (Yahyaoui et al., 2003). The high number of the caprine CSN3 polymorphisms discovered and sequences available during the last years have led to inconsistency in nomenclature. Misunderstandings due to different names for the same variants or identical names shared by different alleles have been widely discussed and new nomenclature has been proposed (Chessa et al., 2003; Jann et al., 2004), based primarily on the GenBank chronological order of the variants.
Recently, 2 additional polymorphisms were identified by PCRsingle-strand conformation polymorphism (SSCP) analysis (Chessa et al., 2003) but not yet characterized. The aims of the present work were 1) the characterization of the mutations responsible for the polymorphisms identified, 2) the development of a simultaneous typing procedure for recently identified CSN3 variants (Chessa et al., 2003; Jann et al., 2004) by PCR-SSCP analysis, and 3) a modification of the CSN3 nomenclature considering the order of reports, allele distribution, and sequence evolution. Finally, the distribution of CSN3 alleles in 7 goat breeds of central Europe, west Africa, and the Asian part of Turkey is presented.
| MATERIALS AND METHODS |
|---|
|
|
|---|
In Silico Sequence Analyses
Calculation of isoelectric points (IP) of the protein corresponding to the DNA sequences of Capra hircus CSN3 was done with the DAMBE program (Xia and Xie, 2001). The 9 amino acids encoded in exon 3 were assumed identical in all variants for this calculation. The DAMBE software was also used to propose the nucleotide sequence-based maximum parsimony trees. For this purpose, DAMBE uses the algorithm originally implemented in the DNAPARS option of the PHYLIP program package (Felsenstein, 1989). To get consensus trees, the input order was randomized (5 times) and bootstrapping and jackknifing was applied (50, 100, or 1000 datasets tested).
PCR-SSCP Analysis
The PCR and subsequent SSCP analysis of 407 bp of exon 4 was carried out using primers KCN I F (5' GGTATCCTAGTTATGGACTCAAT 3') and KCN I R (5' GTTGAAGTAACTTGGGCTGTGT 3') according to Chessa et al. (2003). Reference samples for all the Capra hircus CSN3 variants, except for the CSN3*F variant, were used as standards. For the CSN3*H allele, a plasmid clone (described in Jann et al., 2004) was used as standard. Additionally, longer PCR products (459 bp) were generated for reference samples using primers Kb1 (5' TGTGCTGAGTAGGTATCCTAGTTATGG 3') and Kb2 (5' GCGTTGTCCTCTTTGATGTCTCCTTAG 3') as described by Yahyaoui et al. (2001). These were also used for a second PCR with only forward (Kb1) or only reverse (Kb2) primer and 3 µL of the double-stranded PCR (dsPCR) product as starting template, which generates single-stranded PCR products (ssPCR). Analysis by SSCP was done using the same conditions as for dsPCR products.
PCR-RFLP Analysis
The mutation in position 550 of the CSN3*M allele creates a PstI recognition sequence and was verified by restriction enzyme digestion of 5 to 7 µL of the 407-bp PCR product with 1.5 U of PstI (MBI Fermentas, St. Leon-Roth, Germany) in 20 µL total volume of the buffer supplied by the manufacturer at 37°C. The expected fragments were 334 + 73 bp for CSN3*M and 407 bp for CSN3*F and all other alleles and were separated by standard agarose gel electrophoresis (1.5% agarose in 0.5 x Tris-borate/EDTA buffer).
DNA Samples for Allele Frequency Determination
Two hundred thirty-three DNA samples from Weisse Deutsche Edelziege (Germany, n = 32), Saanen (Italy, n = 22), Borno goat (Nigeria, n = 29), Red Sokoto (Cameroon/Nigeria, n = 31), West African Dwarf (Cameroon/Nigeria, n = 26), Hair goat (Anatolia, Turkey, n = 50), and Angora goat (Anatolia, Turkey, n = 43) were genotyped using the PCR-SSCP procedure according to Chessa et al. (2003). Breed characterizations are available at http://dad.fao.org or http://www.ansi.okstate.edu/breeds/goats/. The Turkish Hair goat is also known as Turkish Native and listed in the Oklahoma State University web page as Anatolian Black. The Borno goat, which is not reported in the FAO web site, is an indigenous population reared in Nigeria. Altogether, these breeds from central Europe, western Africa, and the Asian part of Turkey were chosen to represent geographically distant and separated populations. Allele frequencies were determined by direct counting.
Assignment of New Allele Names
In the case of a specific amino acid substitution, the letter describing a new allele was chosen in alphabetical order following the last reported allele. Alleles with silent nucleotide substitutions were named with the identical letter as the related protein-associated allele and a prime symbol was added.
Changes in Nomenclature
The original allele names were maintained in all cases of unequivocal assignment of a protein-coding DNA variant. For different alleles with identical names given by 2 authors and in the case of different names for the same alleles, the name reported first was chosen (reassigned) in all variants observed in domesticated goats and not only in wild species so far. Alleles resulting from silent mutations were renamed and marked with a prime symbol according to the guideline above for new allele names.
| RESULTS AND DISCUSSION |
|---|
|
|
|---|
|
G substitution, not changing the amino acid, occurs in CSN3*C (AF485341) at position 509. The "X" variant does not include this synonymous mutation and therefore represents a molecular event preceding CSN3*C in the phylogenetic evolution of the gene. At the protein level, CSN3*C and "X" code for the same variant. We therefore propose to change the nomenclature of CSN3*C (AF485341) to CSN3*C' and use the name CSN3*C for the provisionally named "X" variant. In doing so, we maintain the rule of indicating silent mutations by using a prime symbol for the silent allele and a regular letter for the allele corresponding to the protein variant. This underlines again the problem in establishing an allele nomenclature meeting current standards, logic, and discovery timeline aspectsespecially for genes with rapidly growing allele numbers.
The CSN3*M allele, which corresponds to the previously named "Y" pattern (Chessa et al., 2003), results in a new protein variant, differing in 2 nonsynonymous mutations from the CSN3*F allele (Table 1
). A G
A transition at nucleotide position 384, resulting in the amino acid exchange Asp90
Asn90, and an additional C
T transition at position 550, resulting in a Val145
Ala145 substitution, characterize the new variant. The first mutation, involving the exchange of an acid Asp to a neutral Asn, changes the IP compared with the F variant. Nevertheless, it cannot be identified by isoelectric focusing (IEF) of milk samples (Chessa et al., 2003). Calculation of the IP (DAMBE program) for all
-casein variants found in domesticated goats so far reveals only 2 different IP, and the
-casein variants cluster in 2 groups: D, E, K, M (IP = 5.66) and A, B, B', B'', C, C', F, G, H, I, J, L (IP = 5.29). In fact, in IEF of milk samples, only 2 patterns are visible, corresponding to these 2 IP groups. The substitution of Asp to Asn shifts the M variant compared with F to the IP = 5.66 group, but does not enable specific discrimination by IEF. Therefore, we propose to differentiate the nomenclature at the protein level from the one used at the DNA level, by introducing 2 codes corresponding to the IP groups: AIEF, comprising the DNA variants A, B, B', B'', C, C', F, G, H, I, J, L, and BIEF, corresponding to DNA variants D, E, K, and M (Table 1
, all allele names correspond to the newly proposed nomenclature in this paper). In this way, conflicts arising from allele names A and B referring to different variants at the DNA level, and in previous studies carried out by milk protein IEF typing (Di Luccia et al., 1990; Chianese et al., 2000; Caroli et al., 2001) will be avoided. Moreover, an interesting difference was suggested by Chianese et al. (2000) between the 2
-casein IEF variants, as BIEF seems to be associated with higher casein content in milk than AIEF. This finding is probably because, until now, BIEF had been found only in haplotypes with strong alleles at
s1-casein (CSN1S1) and
s2-casein (CSN1S2) loci. Only 2 haplotypes have been detected carrying the CSN3*B allele, renamed CSN3*D in the present paper: CSN1S1*A- CSN1S2*B- CSN3*D and CSN1S1*B-CSN1S2*A- CSN3*D (Sacchi et al., 2005). The importance of monitoring the occurrence of
-casein BIEF in goat milk by routine screening at the protein level is therefore evident.
Maximum parsimony analysis of sequences listed in Table 1
generated 379 most parsimonious trees if no resampling but randomized input order was used. This result underlines the complexity of the mutation events. After bootstrapping and jackknifing options were applied, the same resulting consensus tree was always generated with bootstrapping of either 50 or 100 datasets and jackknifing of either 50 or 1000 data-sets. This consensus tree, indicating a probable nucleotide sequence based evolution of the alleles known up to now, is shown in Figure 1
.
|
|
Analysis of ssPCR by SSCP (Figure 3
) showed that the set of fast-migrating bands corresponds to the sense strand generated by the forward primer, whereas the slower migratingand for genotyping purposes, more informativeset of bands represents the antisense strand (revealed by PCR with the reverse primer). A simple explanation for the higher SSCP variability in the antisense strand might be the difference in GC content, which is 44% in the sense strand and 56% in the antisense strand. Higher GC content might increase the frequency and stability of secondary structures here. The total number of bands visible was reduced by more than 50% when ssPCR was analyzed. This is a strong hint that additional conformers are visible in SSCP analysis of dsPCR, which are probably the result of an interaction of both strands. A similar phenomenon was described by Orita et al. (1989) but not, to our knowledge, further examined until now. Differentiation between variants within the D group and between CSN3*B and B' was not improved by ssPCR-SSCP analysis compared with dsPCR-SSCP analysis. Moreover, discrimination of CSN3*G and H is essentially based on the distance between the major and the secondary band (see Figure 2
). This result was reproducible in our laboratories in Germany and Italy. Therefore, a conventional dsPCR seems to be generally more useful for genotyping by PCR-SSCP in silver-stained gels. On the other hand, knowledge on the migration of bands corresponding to the sense or antisense strand is essential information if analyses on automated sequencers using one fluorescent labeled primer are to be applied. In the case of CSN3, labeling of the reverse primer is strongly recommended for fluorescence-based SSCP analysis.
|
The analysis of the CSN3 variation in 7 goat breeds from Europe, Africa, and the Asian part of Turkey indicates that only a few alleles occur at a rather high frequency. Only 7 out of 11 CSN3 SSCP patterns described here were found among these breeds (Table 2
), as the CSN3*B'', E, H, and J variants were not observed. The prevalent SSCP pattern was CSN3*B/B', with frequencies ranging from 0.260 (Hair goat) to 0.674 (Angora goat). The second most common allele was CSN3*A, with frequencies ranging from 0.151 (Angora goat) to 0.414 (Borno goat). No additional new SSCP patterns were detected. Generally, the African goats showed the lowest variation for CSN3 with only the 2 major alleles detectable in Borno goat and West African Dwarf and additionally CSN3*M, which was found only in the Red Sokoto. The "D group" (D/I/K/L) pattern occurred in only 3 breeds, at a low frequency (0.047) in the Weisse Deutsche Edelziege, slightly higher in Angora goats (0.116), and at an intermediate frequency in the Hair goats (0.250). A similar breed distribution was found for CSN3*C (provisionally "X"), which was present at low frequencies (0.03 to 0.035) in the Weisse Deutsche Edelziege and the 2 Turkish breeds, whereas the silent allele CSN3*C' was found rarely in Weisse Deutsche Edelziege, Saanen, and Hair goats (0.01 to 0.09), but not in the Angora goat. The CSN3*G allele was most frequent in the Hair goat, which was the most diverse breed among those investigated here, with 6 SSCP patterns. Another marked difference in the Hair goat from Turkey was the predominance of CSN3*A instead of CSN3*B/B'. An effect of the higher sample number in this breed (n = 50) cannot be excluded, but such an effect is not very likely as all rare variants (C, C', G, and M) were also detected in breeds with smaller sample sizes. The CSN3*E allele, until now reported only in the Montefalcone breed (Angiolillo et al., 2002), was not detected in our analysis, and this further stresses the possibility that the allele is breed-specific. The CSN3*C' frequency of 9% in Saanen is in accordance with the earlier report of Yahyaoui et al. (2001), who detected 11% CSN3*C' in the same breed and very low (1%) frequencies in 2 Spanish breeds. To our knowledge, this work is the first report of CSN3 allele frequencies in goats from Turkey and Africa. High numbers of alleles were detected in the Hair goat and Angora goat from Anatolia, whereas the African goat breeds and Saanen goats showed rather low variability. The Near East is believed to be one of the domestication centers of cattle, and breeds of this region continue to show higher genetic variability than those found in Europe or Africa (Loftus et al., 1999; Luikart et al., 2001). Allelic variation detected by SSCP analysis at the CSN3 locus indicates a similar situation for domesticated goats.
|
| CONCLUSIONS |
|---|
|
|
|---|
| ACKNOWLEDGEMENTS |
|---|
|
|
|---|
Received for publication November 3, 2004. Accepted for publication January 4, 2005.
| REFERENCES |
|---|
|
|
|---|
-casein gene. J. Dairy Sci. 85:26792680.
-casein (CSN3) in different breeds and characterization at DNA level. Anim. Genet. 32:226230.[Medline]
-Casein polymorphism in caprine milk. Sci. Tecn. Latt.-Cas. 41:305314.
-caseina nella produzione del formaggio Parmigiano-Reggiano. Sci. Tecn. Latt.-Cas. 27:208227.
This article has been cited by other articles:
![]() |
I. Gigli, D. O. Maizon, V. Riggio, M. T. Sardina, and B. Portolano Short Communication: Casein Haplotype Variability in Sicilian Dairy Goat Breeds J Dairy Sci, September 1, 2008; 91(9): 3687 - 3692. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. L. Bai, R. H. Yin, S. J. Zhao, Y. C. Zheng, J. C. Zhong, and Z. H. Zhao Short Communication: Characterization of a {kappa}-Casein Genetic Variant in the Chinese Yak, Bos grunniens J Dairy Sci, March 1, 2008; 91(3): 1204 - 1208. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Chessa, D. Rignanese, F. Chiatti, A. Radeghieri, C. Gigliotti, and A. Caroli Technical Note: Simultaneous Identification of CSN1S2 A, B, C, and E Alleles in Goats by Polymerase Chain Reaction-Single Strand Conformation Polymorphism J Dairy Sci, March 1, 2008; 91(3): 1214 - 1217. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Caroli, F. Chiatti, S. Chessa, D. Rignanese, E. M. Ibeagha-Awemu, and G. Erhardt Characterization of the Casein Gene Complex in West African Goats and Description of a New {alpha}s1-Casein Polymorphism J Dairy Sci, June 1, 2007; 90(6): 2989 - 2996. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Chiatti, S. Chessa, P. Bolla, G. Cigalino, A. Caroli, and G. Pagnacco Effect of {kappa}-Casein Polymorphism on Milk Composition in the Orobica Goat J Dairy Sci, April 1, 2007; 90(4): 1962 - 1966. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Hayes, N. Hagesaether, T. Adnoy, G. Pellerud, P. R. Berg, and S. Lien Effects on Production Traits of Haplotypes Among Casein Genes in Norwegian Goats and Evidence for a Site of Preferential Recombination Genetics, September 1, 2006; 174(1): 455 - 464. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Caroli, F. Chiatti, S. Chessa, D. Rignanese, P. Bolla, and G. Pagnacco Focusing on the goat casein complex. J Dairy Sci, August 1, 2006; 89(8): 3178 - 3187. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |