JDS
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bernabucci, U.
Right arrow Articles by Nardone, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bernabucci, U.
Right arrow Articles by Nardone, A.
J. Dairy Sci. 87:2881-2888
© American Dairy Science Association, 2004.

Abundance of mRNA of Apolipoprotein B100, Apolipoprotein E, and Microsomal Triglyceride Transfer Protein in Liver from Periparturient Dairy Cows*

U. Bernabucci1, B. Ronchi1, L. Basiricò1, D. Pirazzi1, F. Rueca2, N. Lacetera1 and A. Nardone1

1 Dipartimento di Produzioni Animali, Università della Tuscia-Viterbo, Italy
2 Sezione di Medicina Veterinaria Interna, Università di Perugia, Italy

Corresponding author: U. Bernabucci; e-mail: bernad{at}unitus.it.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 CONCLUSIONS
 REFERENCES
 
Limited secretion of very low density lipoproteins (VLDL) in dairy cows is strongly related to fatty liver and other metabolic disorders in the early postpartum. Currently, there is limited information on which roles apolipoprotein B100 (ApoB100), apolipoprotein E (ApoE), and microsomal triglyceride transfer protein (MTP) play in that VLDL limitation. To our knowledge, no studies have simultaneously measured ApoB100, ApoE, and MTP mRNA in periparturient dairy cows. Therefore, a trial was conducted to assess liver gene expression of these proteins in transition dairy cows and to evaluate the relationships between their expression and metabolic status. Eight multiparous Holstein cows were monitored during the transition period. To evaluate metabolic and nutritional status, body condition score was registered, and plasma indexes of energy metabolism and VLDL were determined from 35 d before to 35 d after calving. Liver biopsies were performed on d –35, 3, and 35 relative to day of calving, and gene expression of ApoB100, ApoE, and MTP were determined on liver tissue. Body condition, plasma glucose and VLDL decreased, and plasma NEFA and BHBA increased after calving. Compared with values of d –35, on d 3 after calving the ApoB100 mRNA synthesis was lower, whereas MTP and ApoE mRNA abundance were higher. Negative correlation (r = –0.57) between plasma NEFA concentration and ApoB100 mRNA abundance, and positive correlation between ApoB100 mRNA abundance and plasma cholesterol (r = 0.65) and plasma albumins (r = 0.52) were detected at 3 d postpartum. Data on changes of gene expression of the 3 main proteins involved in the regulation of synthesis and secretion of VLDL in the liver suggest that decreased mRNA for ApoB100 may be consistent with decreased synthesis and/or secretion of VLDL from liver during the peripart-urient period.

Key Words: apolipoprotein B • apolipoprotein E • mRNA • liver

Abbreviation key: ApoB100 = apolipoprotein B100, ApoE = apolipoprotein E, GAPDH = glyceraldehyde-3-phosphate dehydrogenase, HDL = high density lipoprotein, LDL = low density lipoprotein, MTP = microsomal triglyceride transfer protein, RT-PCR = reverse transcription-polymerase chain reaction, TG = triglyceride, VLDL = very low-density lipoprotein


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 CONCLUSIONS
 REFERENCES
 
The peripartum period is the most important phase of the production cycle of dairy cows. Most health problems occur during this phase. During the last phase of pregnancy, energy intake is reduced and nutrient demands by the fetus and mammary gland growth are increased (Bell, 1995). These conditions, together with changes in hormonal equilibrium, lead to an increase in fat mobilization with consequent increased plasma NEFA and rate of fatty acids uptake from the liver (Grummer, 1995). When the rate of hepatic triglycerides (TG) synthesis exceeds the rate of TG disappearance, accumulation of TG and cholesterol esters in hepatocytes takes place with high risk for fatty liver. Triglycerides may disappear through hydrolysis or secretion via very low density lipoproteins (VLDL) synthesis. Ruminants have the same rate of TG synthesis in the liver compared with nonruminants but have a very slow rate of hepatic VLDL secretion relative to nonruminants (Pullen et al., 1990). The regulation and coordination of lipid metabolism among several tissues (liver, adipose, gut, mammary gland) are key components of the adaptation to lactation (Drackley, 1999). The synthesis of VLDL requires TG, phospholipids, cholesterol, cholesterol esters, apolipoproteins (B100, C, and E) and microsomal triglyceride transfer protein (MTP) (Mensenkamp et al., 2001; Shelness and Sellers, 2001; Fisher and Ginsberg, 2002). The limiting step of VLDL synthesis in ruminants is unknown; Bauchart (1993) hypothesized that it is probably represented by the availability of VLDL constituents. Microsomal triglyceride transfer protein transfers neutral lipids from outside the endoplasmic reticulum to the lumen and plays a fundamental role in coordinating the assembly of VLDL (Hussain et al., 2003). The MTP appears to be involved in the first step of lipidation of the newly synthesized apolipoprotein B100 (ApoB100) molecule (MTP facilitates the association of cholesteryl ester, triglyceride, and phospholipid with ApoB100) resulting in the formation of nascent lipoprotein particles (Watterau et al., 1997). Apolipoprotein B100 is the TG-binding protein in VLDL, it is the most important structural component of VLDL and it is necessary for stabilizing the VLDL particles (Gibbons, 1990). Recent studies revealed the role of apolipoprotein E (ApoE) in the control of intra-cellular lipid metabolism and VLDL production by the hepatocytes (Mensenkamp et al., 2001). Nascent VLDL particles acquire the ApoE during the assembly/secretion cascade (Fazio et al., 1992; Fazio and Yao, 1995), and animal studies and in vitro experiments demonstrated the role of ApoE in the regulation of VLDL secretion by the liver (Mensenkamp et al., 2001). To our knowledge, no studies investigated ApoE gene expression in periparturient dairy cows.

Regulation of tissue-specific gene expression is of great interest. Its study is possible using RNA as a parameter of gene expression (Farrell, 1998). Messenger-RNA biogenesis, maturity, and function are influenced transcriptionally and posttranscriptionally and together constitute myriad regulation control points within the cell.

Therefore, a trial was conducted to assess liver gene expression of ApoB100, ApoE, and MTP, the 3 main proteins involved in the VLDL assembly and secretion in liver, and to evaluate the relationship between their expression and metabolic status in periparturient dairy cows to get a better understanding of what may be limiting VLDL secretion.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 CONCLUSIONS
 REFERENCES
 
Management of Cows
The trial was carried out in a commercial dairy herd. The average milk yield per lactation (305 DIM) of the herd was about 9000 kg per cow, and fat and protein contents of the milk were 3.7 and 3.3%, respectively. Eight multiparous Holstein cows due to calve in June were monitored from 35 d prepartum to 35 d postpartum. Cows were fed diets for dry cows and lactating cows: Table 1Go, consisting of a base-ration fed as a TMR given daily at 0930 h and offered ad libitum to achieve 5 to 10% refusals. The close-up diet was offered starting 10 d before the expected calving.


View this table:
[in this window]
[in a new window]
 
Table 1. Ingredients and nutrients composition of diets fed during the experimental period (DM basis).
 
Measurements and Samplings
Feeds were sampled and analyzed. Dry matter was determined by forced air oven drying at 65°C to constant weight. Crude protein was determined by macro-Kjeldhal method (AOAC, 1984). Ether extract and ash were determined according to AOAC methods (AOAC, 1984). The NDF was analyzed according to the method described by Goering and Van Soest (1970).

During the experimental period body condition of cows was scored by one person weekly following the method of ADAS (1986). Blood samples were taken at 0800 h from the jugular vein at –35, –27, –20, –12, and –4 prepartum (before expected calving) and at 3, 10, 17, 24, 30, and 35 postpartum. Blood samples were collected in Vacutainer tubes containing Li-heparin as anticoagulant agent and put in ice. Blood was centrifuged at 2700 xg for 10 min at 4°C. Aliquots of plasma were stored at –20°C until analyzed for glucose, cholesterol, and albumins (kits from Instrumentation Laboratory, Lexington, MA), BHBA (Barnouin et al., 1986) and NEFA (NEFA-C kit; Wako Fine Chemical Industries USA, Inc., Dallas TX). On d –35, 3, and 35 relative to day of calving blood samples were collected in Vacutainer tubes without anticoagulants. Serum was obtained by centrifuging blood at 2700 xg for 10 min at 4°C. Very low density, low density (LDL), and high density (HDL) lipoproteins were separated on agarose gel (Hydragel Lipo+Lp(a), Sebia Electrophoresis, Norcross, GA) and the relative quantification was done by densitometric scanning (Contois et al., 1999). The assay is based on the separation of HDL, LDL, and VLDL on agarose gels, followed by enzymatic cholesterol staining (Contois et al., 1999).

Liver biopsies (Vazquez-Anon et al., 1994) were performed on d –35, 3, and 35 relative to day of calving after first locating the liver by ultrasound. The biopsy samples were obtained from the right lobe of the liver inserting the needle through the 10th or 11th intercostal space.

Immediately after collection, liver samples were rinsed in RNase-free water (diethyl-pyrocarbonate-treated water), frozen in liquid nitrogen, and stored at –80°C until the ribonuclease protection assay of ApoB100, ApoE, and MTP mRNA (Ilian et al., 1999).

Quantification of ApoB100, ApoE, and MTP mRNA by Ribonuclease Protection Assay
Isolation of total RNA from liver tissue.
Total RNA was isolated by homogenizing biopsies (50 to 100 mg of liver tissue) in 1 mL of TRI reagent solution containing phenol and guanidinium thiocyanate (Sigma-Aldrich, Milan, Italy) following the procedure described by the manufacturer. The homogenate was incubated in 100 µL of 2 M Na-acetate (pH 4) and 200 µL of chloroform:isoamyl-alcohol, incubated in ice for 15 min. After incubation, the mixture was centrifuged at 14,000 xg for 15 min at 4°C. Following centrifugation, to precipitate RNA, the colorless aqueous phase was transferred to a fresh tube and an equal volume of ice cold isopropanol was added. The mixture was incubated at –20°C for 1 h. After incubation, the mixture was centrifuged at 14,000 xg for 15 min at 4°C, the pellet was washed twice with 75% ethanol by centrifugation at 14,000 xg for 5 min at 4°C. The pellet was redissolved in RNase-free water and incubated for 10 min at 55°C. Total RNA was quantified by measuring its absorbance at 260 nm. To verify integrity, cellular RNA (10 µg) was electrophoresed on 1.2% agarose—2.2% formaldehyde denaturing gel in 1 x MOPS [3-(n-morpholino)propanesulfonic acid] and stained with ethidium bromide. Cellular RNA that had intact 28S and 18S ribosomal bands were used in subsequent analyses. Isolated RNA was stored at –80°C until the ribonuclease protection assay.

Synthesis of RNA probes of human ApoB100, bovine ApoE, MTP, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH).
Specific antisense ribonucleotide probes were generated using cDNA of ApoB100, ApoE, MTP, and GAPDH, which was used as internal control, that were produced from bovine liver RNA by reverse transcription-polymerase chain reaction (RT-PCR).

The MTP RNA probe-oligonucleotide primers of MTP used for RT-PCR (forward: 5'-AGACTGAAGCCAGGA AAGCA-3'; reverse: 5'-TAATACGACTCACTATAGGG AGTGA GCAGAGGTGACAGCATC-3') were designed from the bovine MTP cDNA. The reverse transcription reaction mixture (Superscript, II, GIBCO-BRL, Life Technologies, Gaithersberg, MD), and 200 U of Superscript II RNase H-reverse transcriptase (GIBCO-BRL, Life Technologies), were incubated at 70°C for 10 min. The subsequent reverse transcription reaction was carried out at 42°C for 50 min. Polymerase chain reaction was used to amplify a 305-bp MTP cDNA fragment. The total PCR reaction mixture of 100 µL contained 5 U of Taq DNA polymerase (GIBCO-BRL, Life Technologies). To check for specificity, PCR products were analyzed by 1% agarose gel electrophoresis, TBE buffer (0.89 M Tris, 0.89 M boric acid, 20 mM EDTA, pH 8.2) and 0.5 µg/mL of ethidium bromide.

The ApoB100 RNA probe, a 378-bp ApoB100 cDNA, was produced by using procedures similar to those described for MTP. Oligonucleotide primers of ApoB100 used for RT-PCR (forward: 5'-GCAAGGAGCAACACCTCTTC-3'; reverse: 5'-TAATACGACTCACTATAGGGAGGTCCACACTGAACCAAGGTC-3') were designed from the human ApoB100 cDNA.

The ApoE RNA probe, a 265-bp ApoE cDNA, was synthesized as described above for MTP. Oligonucleotide primers of ApoE used for RT PCR (forward: 5'-AT GAAGGTTCTGTGGGTTGC-3'; reverse: 5'-TAATACG ACTCACTATAGG GAGATGAAGGTTCTGTCGGTTG C-3') were designed from the bovine ApoE cDNA.

The GAPDH RNA probe, a 177-bp GAPDH cDNA, was amplified by using 2 synthetic oligonucleotide primers (forward: 5'-TCATCCCTGCTTCTACTGGC-3'; reverse: 5'-TAATACGACTCACTATAGGGAGCCTGCTTCACCACCT TCTTG-3') from the bovine GAPDH cDNA.

The PCR products, containing sequence of the T7 promoter at the 5' end, were transcribed in vitro directly using a Maxiscript transcription Kit (Ambion, Inc., Austin, TX) according to the manufacturer’s instructions. The reaction mixture contained: 1 µg of template DNA, 2 µL of 10 x transcription buffer, 1 µL of 10 mM ATP, CTP, GTP, UTP, and finally 2 µL of T7 RNA polymerase. Transcription was carried out at 37°C for 60 min. The DNA template was digested with DNase I for 15 min at 37°C. After transcription, all riboprobes were purified by electrophoresis on a 5% TBE-8 M urea acrylamide gel. The product bands were visualized by staining in 2 µg/mL acridine orange in nuclease-free water for 15 min, excised from the gel and eluted passively from gel slices in 0.5 M ammonium acetate, 1 mM EDTA and 0.2% SDS overnight. Following EtOH precipitation, the RNA probes were resuspended in H2O and quantitated by checking the absorbance reading at 260 nm.

The purified riboprobes were labeled with biotin using Brightstar Psoralen-Biotin Kit (Ambion, Inc.) according to the manufacturer’s instructions. The labeling was carried out by mixing the riboprobes with the Psoralen-Biotin reagent in a microtiter plate and exposing to long wavelength (365 nm) UV light. The Psoralen-Biotin reagent became covalently linked to the riboprobes in 45 min. Any excess Psoralen-Biotin reagent was removed by butanol extraction, and the probe was stored at –80°C until use.

Ribonuclease protection assay.
Hybridization of total RNA with riboprobes was performed using the protocol and reagents supplied in the RPA III kit (Ambion, Inc.) as described for the standard procedure. Target RNA samples (10 µg) and riboprobes (approximately 1 ng per riboprobe) were coprecipitated with ammonium acetate (0.5 M) and ethanol. Yeast RNA from the RPA III kit (10 µg/2 µL) was used as negative control. The RNA samples and riboprobes were subsequently processed following the procedure described by the manufacturer (Ambion, Inc.). The samples were dissolved in hybridization buffer and incubated overnight at 56°C. Unhybridized probes and RNA were digested by RNase A/T1 mixture in digestion buffer for 30 min at 37°C. The digestion was stopped by adding cold inactivation/precipitation solution. The mixture was then incubated at –20°C for 1 h and centrifuged at 14,000 xg for 15 min at 4°C.

The samples were dissolved in gel loading buffer, boiled for 3 min, placed in ice, and loaded on 5% acrylamide gel containing 8 M urea in 1 x TBE. Gel electrophoresis was performed at 250 V for 1 h in a Hoefer model SE 600 gel apparatus (Hoefer Amersham Pharmacia Biotech, UK). The mRNA was then electrophoretically transferred to a positively charged nylon membrane (BrightStar-Plus) in a TE42 Transphor transfer unit (Hoefer Amersham Pharmacia Biotech) with 0.1 x TBE for 45 min at 100 mA.

For the quantitative analysis of MTP, ApoB100, and ApoE mRNA known amounts of in vitro synthesized MTP, ApoB100, ApoE sense RNA were hybridized with an excess of labeled antisense probes to construct the standard curves. Figure 1Go reports the standard curve constructed for MTP.



View larger version (28K):
[in this window]
[in a new window]
 
Figure 1. Example of a standard concentration curve constructed using known amounts of in vitro synthesized ‘sense strand RNA’ hybridized with an excess of labeled antisense probe. Ribonuclease protection assay were performed on 10, 20, 50, 100, 200 and 400 pg samples of MTP sense RNA (y = 0.0022x + 3.9037, R2 = 0.9988). The reaction products were resolved on a denaturing 5% polyacrylamide gel and then quantified with the Kodak EDAS-290 densitometer and ID Image Analysis software (Eastman Kodak Company, Rochester, NY).

 
Chemiluminescent detection.
The mRNA was cross-linked to the wet membrane after the transfer by heating in an oven at 80°C for 15 min. The nonisotopic detection of the probe fragments protected was performed using BrightStar and BioDetect kits (Ambion, Inc.) following the procedure described by the manufacturer. The membrane was washed twice in wash buffer and incubated in a blocking solution for 30 min, then with streptavidin-alkaline phosphatase conjugate for 30 min. Then blot was rinsed in wash buffer, followed by incubation in CDP-Star at room temperature for 5 min, excess liquid was shaken off, and finally membrane was exposed to Kodak BioMax Light film (Eastman Kodak Co., Rochester, NY).

Densitometry.
Chemiluminescent films were analyzed with the Kodak EDAS-290 densitometer and ID Image Analysis software (Eastman Kodak Co.). Samples were analyzed in conjunction with the standard curve and the intensity of the probe fragments protected by specific mRNA from the target samples was compared to the standard curve to determine the absolute amounts of ApoB100, MTP, and ApoE mRNA.

Statistical Analysis
Data were analyzed as repeated measures using the MIXED procedure of SAS (SAS, 1999) according to the following model:


where

Yij=dependent variable

µ=overall mean of the population

Di=mean effect of day of sampling (i = 1,...3 for MTP, ApoB100, and ApoE; i = 1,...11 for BCS, and metabolic parameters); and

eij=unexplained residual element assumed to be independent and normally distributed.

Data were analyzed across sampling days relative to day of calving with d 0 representing the day of calving. For each analyzed variable, cow was subjected to 3 covariance structures: compound symmetric, autoregressive order one, and unstructured covariance. The covariance structure that had the largest Akaike’s information criterion and Schwarz’s Bayesian criterion was considered the most desirable analysis. For all parameters tested the best covariance structure was compound symmetric. Comparisons for the time factor was made only if the F-test was significant. Least square means were separated with the PDIFF procedure of SAS (1999). Correlation coefficients among different variables were determined by the CORR procedure of SAS (SAS, 1999). Significance was declared at P < 0.05 and trends at P < 0.10.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 CONCLUSIONS
 REFERENCES
 
Body Condition Score and Plasma Indexes
Thirty-five days before calving the mean value of BCS of the 8 cows was 3.3 ± 0.2 and none of the 8 cows lost body condition approaching the calving event (Table 2Go). After calving BCS showed a significant (P < 0.05) decrease reaching the minimum values (2.0 ± 0.2) at 35 DIM. The decrease of BCS after calving was 0.9 ± 0.2 and 1.3 ± 0.2 U after 17 and 35 DIM, respectively.


View this table:
[in this window]
[in a new window]
 
Table 2. Least square means and standard error for BCS and plasma parameters during the transition period.
 
Plasma glucose concentrations were lower (P < 0.01) after calving and started to recover only at 35 DIM (Table 2Go). The NEFA and BHBA plasma concentrations were higher (P < 0.01) after calving compared with levels registered before calving (Table 2Go). The NEFA reached the maximum level (0.864 ± 0.081 mmol/L) 3 d after calving, and BHBA reached the maximum (1.433 ± 0.164 mmol/L) at 17 DIM.

Plasma albumin showed a decrease (P < 0.05) subsequent to calving and recovered 3 to 4 wk after calving (Table 2Go). Cholesterol started to decrease (P < 0.05) about 2 wk before calving reaching the minimum value 3 d after calving, then increased until the end of the trial (Table 2Go). Relative proportion of serum VLDL was lower (P < 0.01) and HDL was higher (P < 0.05) after calving. The LDL did not significantly change during the transition period (Figure 2Go).



View larger version (13K):
[in this window]
[in a new window]
 
Figure 2. Least square means and standard error for serum high density lipoprotein (HDL), low density lipoprotein (LDL), and very low density lipoprotein (VLDL) during the transition period. Data are reported as relative percentage between the three lipoproteins. a, b = P < 0.05 for HDL, A, B = P < 0.01 for VLDL.

 
MTP, ApoB100, and ApoE Gene Expression
We used GAPDH gene expression as internal control. The GAPDH mRNA relative to value measured at 35 d before calving were (means ±SD) 1.05 ± 0.10 and 0.96 ± 0.02 at 3 and 35 d after calving, respectively.

During transition period gene expression of all proteins tested showed significant changes (Figure 3Go). The MTP mRNA abundance showed the highest values (P < 0.05) 3 d after calving and the lowest values (P < 0.05) at 35 DIM. ApoB100 mRNA showed lower values (P < 0.05) after calving, and no significant difference was found between values observed at 3 and 35 d postpartum. The gene expression of ApoE was higher after calving and showed the highest values 3 d postpartum.



View larger version (11K):
[in this window]
[in a new window]
 
Figure 3. Least square means and standard error for microsomal triglyceride transfer protein (MTP) (A), apolipoprotein B100 (ApoB100) (B) and apolipoprotein E (ApoE) (C) mRNA abundance in liver of transition dairy cows. Values are reported as pg mRNA/µg total RNA. a, b, c = P < 0.05.

 
Significant correlations between NEFA, cholesterol, and ApoB100 mRNA abundance at 3 d postpartum were detected (Table 3Go).


View this table:
[in this window]
[in a new window]
 
Table 3. Pearson correlation coefficients (r) between plasma metabolic parameters and apolipoprotein B100 (ApoB100) mRNA abundance at 3 d postpartum.
 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 CONCLUSIONS
 REFERENCES
 
Changes of BCS, plasma glucose, NEFA, BHBA, cholesterol, and albumin and serum lipoproteins around parturition observed in the present study can be considered physiological and due to the negative energy balance and changes in the activity of liver which are generally observed during the transition period in dairy cows (Reid et al., 1983; Gerloff, 1987; Bertics et al., 1992; Vazquez-Anon et al., 1994; Drackley et al., 2001; Bobe et al., 2003). Total cholesterol is a constituent of several lipoproteins and its reduction could reflect the possible alteration of liver synthesis also associated with fatty liver (Herdt et al., 1983; Reid et al., 1983; Artekar and Desai, 2003). Albumin is an indicator of liver function; it decreases in the peripartum period and its reduction could be associated with hepatocellular liver diseases (Tennant, 1997) and fatty liver (Reid et al., 1983; Nehra et al., 2001).

In contrast, with data reported by Rhoads et al. (2003) we did not find any effect of the physiological phase on GAPDH gene expression during the transition period.

In the present study we found an increase of MTP mRNA abundance after calving and no relationships between MTP mRNA and metabolic parameters were detected. Bremmer et al. (2000a) reported a significant increase of MTP mRNA 2 d after calving, in agreement with our results, and no relationships between MTP activity, mass or mRNA with plasma NEFA or liver TG concentration. In a second study, Bremmer et al. (2000b) evaluated the effects of nutritional and hormonal status on gene expression, protein mass, and activity of MTP in nonlactating Holstein cows and in bovine primary cultured hepatocytes. Results of that study suggested that hepatic MTP mRNA may be affected by TG accumulation, insulin, and glucagon in vitro, but the same treatments did not affect MTP mass or activity. Data of our study and data from Bremmer et al. (2000a) clearly demonstrated the up-regulation of MTP gene expression in the early postpartum period. In agreement with conclusion of Bremmer et al. (2000a, 2000b), MTP probably does not play a critical role in the etiology of fatty liver that occurs in dairy cows at calving.

Studies support the concept that ApoB100 secretion is metabolically regulated (Adeli et al., 1995). In studies carried out on laboratory animals and on cultured hepatocytes various metabolic states such as food deprivation and carbohydrate overload and FFA or insulin alter or modulate the level of ApoB100 secretion without any modification of the ApoB100 mRNA level (Adeli et al., 1995; Gruffat et al., 1996). Serum ApoB100 concentration was decreased in cows with fatty liver induced by ethionine (Uchida et al., 1992) and those with natural fatty liver (Marcos et al., 1990b). Katoh (2002) reviewed a decrease of serum ApoB100 concentration in cows with ketosis, left displacement of abomasums, retained placenta, milk fever, and downer syndrome. This author concluded that the decrease of serum ApoB100 concentration in cows with health problems are primarily attributable to fatty liver. In contrast, Mazur et al. (1992) reported that an impaired synthesis of ApoB100 may result in its decreased availability for lipoprotein formation and in turn results in enhanced triglyceride accumulation.

In the lactation cycle, serum ApoB100 concentration is low during early lactation (Marcos et al. 1990a; Gruffat et al., 1997). Gruffat et al. (1997) found a reduction of hepatic ApoB100 concentration in lactating cows at 1, 2, and 4 wk after calving compared with pregnant nonlactating cows and cows at 12 wk in milk. In contrast, the same authors reported that hepatic concentration of ApoB100 mRNA did not vary significantly during early lactation and that it was not statistically different when compared with data of pregnant nonlactating cows. Those authors hypothesized that ApoB100 synthesis during early lactation is regulated posttranscriptionally by either decreased translation or increased rate of intracellular proteolytic degradation. Results obtained from laboratory animals and humans indicated that among different possible mechanisms operating in mammals, intracellular translation of ApoB100 mRNA and degradation of ApoB100 are more likely to be the key regulatory mechanisms controlling the acute regulation of ApoB100 production by the liver (Adeli et al., 1995). In contrast, the exact mechanism for the depression in both circulating and hepatic reduction of ApoB100 concentration in the early postpartum period of dairy cows is not known yet.

Gruffat-Mouty et al. (1999) measured hepatic ApoB synthesis and VLDL secretion in ruminant and rodent liver cells and concluded that the slow rate of secretion of VLDL in calf liver cells was not consecutive to a low rate of synthesis of ApoB but rather to a defect in VLDL assembly and/or secretion. Marcos et al. (1990b) reported that the level of liver ApoB mRNA in fatty liver cows was lower than in control cows and concluded that hepatic apolipoprotein synthesis is impeded in fatty liver cows.

Even though Gruffat et al. (1997) reported nonstatistical differences between early lactating and pregnant dry cows, ApoB100 mRNA in lactating cows 1 wk after calving was 67% of that registered in pregnant dry cows. We found a significant decrease of ApoB100 mRNA abundance after calving (–27%) compared with data before calving and no statistical difference was found during lactation (Figure 3Go). Changes of ApoB100 mRNA abundance and relationships between ApoB100 mRNA and plasma NEFA, cholesterol and albumins observed in the present study, would indicate a possible regulation at transcriptional level of ApoB100 in the early postpartum period other than at posttranscriptional level as exclusively suggested by Gruffat et al. (1997).

To our knowledge, no data are available on changes of ApoE mRNA in periparturient dairy cows. Recent studies demonstrated that in ApoE-deficient mice VLDL-triglyceride secretion was severely impaired and mice developed fatty liver (Mensenkamp et al., 2001). Those authors have established the implication of ApoE in lipoprotein clearance and in the regulation of lipoprotein secretion by the liver, even though the exact mechanism is not clear yet. The upregulation of ApoE gene expression in the early postpartum, found in the present study, might be explained by the response of hepatocytes to the increased TG availability for VLDL synthesis. Considering our results and finding of Takahashi et al. (2003a, b), ApoE might be excluded as the possible factor implicated in the etiology of fatty liver at calving.


    CONCLUSIONS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 CONCLUSIONS
 REFERENCES
 
Data on changes of gene expression of the 3 main proteins involved in the regulation of synthesis and secretion of VLDL in the liver suggest that decreased mRNA for ApoB100 may be consistent with decreased synthesis and/or secretion of VLDL from liver during the periparturient period.

The mechanism by which ApoB100 gene expression is downregulated and MTP and ApoE are upregulated in the early postpartum was not established.


    FOOTNOTES
 
* Research was financially supported by University of Tuscia and PRIN-MIUR 2003. Back

Received for publication January 12, 2004. Accepted for publication March 3, 2004.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 CONCLUSIONS
 REFERENCES
 


ADAS–Agricultural Development and Advisory Service. 1986. Condition scoring of dairy cows. Publ. 612, Agric. Dev. Advisory Serv., Min. Agric., Fisheries Food (Publ.), Lion House, Alnwick, Northumberland, UK.

Adeli, K., A. Mohammadi, and J. Macri. 1995. Regulation of apolipoprotein B biogenesis in human hepatocytes: Posttranscriptional control mechanisms that determine the hepatic production of apolipoprotein B-containing lipoproteins. Clin. Biochem. 28:123–130.[Medline]

AOAC–Association of Official Analytical Chemists. 1984. Official Methods of Analysis. 14th ed. AOAC, Washington, DC.

Artekar, T. M., and H. G. Desai. 2003. Fatty liver with elevated transaminase levels due to heterozygous apolipoprotein B deficiency. Trop. Gastroenterol. 24:35–36.[Medline]

Barnouin, J., N. El Idilbi, Y. Chilliard, J. P. Chacornac, and R. Lefaivre. 1986. Micro-dosage automatisé sans dé proté inisation du 3-hydroxybutyrate plasmatique chez les bovins. Ann. Rech. Vét. 17:129–139.[Medline]

Bauchart, D. 1993. Lipid absorption and transport in ruminants. J. Dairy Sci. 76:3864–3881.[Abstract/Free Full Text]

Bell, A. W. 1995. Regulation of organic nutrient metabolism during transition from late pregnancy to early lactation. J. Anim. Sci. 73:2804–2819.[Abstract]

Bertics, S. J., R. R. Grummer, C. Codorniga-Valino, and E. E. Stoddard. 1992. Effect of prepartum dry matter intake on liver triglyceride concentration in early lactation. J. Dairy Sci. 75:1914–1923.[Abstract]

Bobe, G., B. N. Ametaj, J. W. Young, and D. C. Beitz. 2003. Effects of exogenous glucagon on lipids in lipoproteins and liver of lactating dairy cows. J. Dairy Sci. 86:2895–2903.[Abstract/Free Full Text]

Bremmer, D. R., S. J. Bertics, S. A. Besong, and R. R. Grummer. 2000a. Changes in hepatic microsomal triglyceride transfer protein and triglyceride in periparturient dairy cattle. J. Dairy Sci. 83:2252–2260.[Abstract]

Bremmer, D. R., S. L. Trower, S. J. Bertics, S. A. Besong, U. Bernabucci, and R. R. Grummer. 2000b. Etiology of fatty liver in dairy cattle: Effects of nutritional and hormonal status on hepatic microsomal triglyceride transfer protein. J. Dairy Sci. 83:2239–2251.[Abstract]

Contois, J. H., R. G. Gillmor, R. E. Moore, L. W. Contois, J. L. Macer, and A. H. B. Wu. 1999. Quantitative determination of cholesterol in lipoprotein fraction by electrophoresis. Clin. Chim. Acta 282:1–14.[Medline]

Drackley, J. K. 1999. Biology of dairy cows during the transition period: The final frontier? J. Dairy Sci. 82:2259–2273.[Abstract]

Drackley, J. K., T. R. Overton, and G. N. Douglas. 2001. Adaptation of glucose and long-chain fatty acid metabolism in liver of dairy cows during the periparturient period. J. Dairy Sci. 84(E. Suppl.):E100–E112.[Abstract/Free Full Text]

Farrell, R. E. Jr. 1998. RNA Metodologies. 2nd ed. Academic Press, Harcourt Brace & Co., San Diego, CA.

Fazio, S., and Z. Yao. 1995. The enhanced association of apolipoprotein E with apolipoprotein B-containing lipoproteins in serum-stimulated hepatocytes occurs intracellularly. Arterioscler. Thromb. Vasc. Biol. 15:593–600.[Abstract/Free Full Text]

Fazio, S., Z. Yao, B. J. McCarthy, and S. C. Rall Jr. 1992. Synthesis and secretion of apolipoprotein E occurs independently of synthesis and secretion of apolipoprotein B-containing lipoproteins in HepG2 cells. J. Biol. Chem. 267:6941–6945.[Abstract/Free Full Text]

Fisher, E. A., and H. N. Ginsberg. 2002. Complexity in the secretory pathway: The assembly and secretion of apolipoprotein B-containing lipoproteins. J. Biol. Chem. 277:17377–17380.[Free Full Text]

Gerloff, B. J. 1987. Body condition scoring in dairy cattle. Agri-Practice 6:31–36.

Gibbons, G. F. 1990. Assembly and secretion of hepatic very-low-density lipoprotein. Biochem. J. 268:1–13.[Medline]

Goering, H. K., and P. J. Van Soest. 1970. Forage Fiber Analyses (Apparatus, Reagents, Procedures, and some Applications). Agric. Handbook no. 379. ARS-USDA, Washington, DC.

Gruffat, D., D. Durand, B. Graulet, and D. Bauchart. 1996. Regulation of VLDL synthesis and secretion in the liver. Reprod. Nutr. Dev. 36:375–389.

Gruffat, D., D. Durand, Y. Chilliard, P. Williams, and D. Bauchart. 1997. Hepatic gene expression of apolipoprotein B100 during early lactation in underfed, high producing dairy cows. J. Dairy Sci. 80:657–666.[Abstract/Free Full Text]

Gruffat-Mouty, D., B. Graulet, D. Durand, M. E. Samson-Bouma, and D. Bauchart. 1999. Apolipoprotein B production and very low density lipoprotein secretion by calf liver slices. J. Biochem. 126:188–193.[Abstract/Free Full Text]

Grummer, R. R. 1995. Impact of changes in organic nutrient metabolism on feeding the transition dairy cow. J. Anim. Sci. 73:2820–2833.[Abstract]

Herdt, T. H., J. Liesman, B. Gerloff, and R. Emery. 1983. Reduction of serum triacylglycerol-rich lipoprotein concentrations in cows with hepatic lipidosis. Am. J. Vet. Res. 44:293–296.[Medline]

Hussain, M. M., J. Shi, and P. Dreizen. 2003. Microsomal triglyceride transfer protein and its role in apoB-lipoprotein assembly. J. Lipid Res. 44:22–32.[Abstract/Free Full Text]

Ilian, M. A., R. S. Gilmour, and R. Bickerstaffe. 1999. Quantification of ovine and bovine calpain I, calpain II, and calpastain mRNA by ribonuclease protection assay. J. Anim. Sci. 76:853–864.

Katoh, N. 2002. Relevance of apolipoproteins in the development of fatty liver and fatty liver-related peripartum diseases in dairy cows. J. Vet. Med. Sci. 64:293–307.[Medline]

Marcos, E., A. Mazur, P. Cardot, and Y. Rayssiguier. 1990a. The effects of pregnancy and lactation on serum lipid and apolipoprotein B and A-I levels in dairy cows. J. Anim. Physiol. Anim. Nutr. 64:133–138.

Marcos, E., A. Mazur, P. Cardot, and Y. Rayssiguier. 1990b. Serum apolipoprotein B and A-I and naturally occurring fatty liver in dairy cows. Lipids 25:575–577.[Medline]

Mazur, A., M. Ayrault-Jarrier, Y. Chilliard, and Y. Rayssiguier. 1992. Lipoprotein metabolism in fatty liver dairy cows. Diabete Metab. 18:145–149.

Mensenkamp, A. R., L. M. Havekes, J. A. Romijn, and F. Kuipers. 2001. Hepatic steatosis and very low density lipoprotein secretion: The involvement of apolipoprotein E. J. Hepatol. 35:816–822.[Medline]

Nehra, V., P. Angulo, A. L. Buchman, and K. D. Lindor. 2001. Nutritional and metabolic considerations in the etiology of nonalcoholic steatohepatitis. Digest. Dis. Sci. 46:2347–2352.

Pullen, D. L., J. S. Liesman, and R. S. Emery. 1990. A species comparison of liver slice synthesis and secretion of triacylglycerol form nonesterified fatty acids in media. J. Anim. Sci. 68:1395–1399.[Abstract]

Reid, I. M., G. J. Rowlands, A. M. Dews, R. A. Collins, and R. Manston. 1983. The relationship between post-parturient fatty liver and blood composition in dairy cows. J. Agric. Sci. (Camb.) 101:473–480.

Rhoads, R. P., C. McManaman, K. L. Ingvarsten, and Y. R. Boisclair. 2003. The housekeeping genes GAPDH and cyclophilin are regulated by metabolic state in the liver of dairy cows. J. Dairy Sci. 86:3423–3429.[Abstract/Free Full Text]

SAS User’s Guide: Statistics, Version 8.0 Edition. 1999. SAS Inst., Inc., Cary, NC.

Shelness, G. S.; and J. A. Sellers. 2001. Very-low lipoprotein assembly and secretion. Curr. Opin. Lipidol. 12:151–157.[Medline]

Takahashi, Y., F. Itho, T. Oohashi, and T. Miyamoto. 2003a. Distribution of apolipoprotein E among lipoprotein fractions in the lactating cow. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 136:905–912.[Medline]

Takahashi, Y., K. Sato, F. Itoh, T. Miyamoto, T. Oohashi, and N. Katoh. 2003b. Bovine apolipoprotein E in plasma: Increase of ApoE concentration induced by fasting and distribution in lipoprotein fractions. J. Vet. Med. Sci. 65:199–205.[Medline]

Tennant, 1997. Hepatic function. Pages 327–366 in Clinical Biochemistry of Domestic Animals. J. J. Kaneko, J. W. Harvey, and M. L. Bruss, eds. Academic Press, San Diego, CA.

Uchida, E., N. Katoh, and K. Takahashi. 1992. Induction of fatty liver in cows by ethionine administration and concomitant decrease of serum apolipoprotein B100 and A-I concentrations. Am. J. Vet. Res. 53:2035–2042.[Medline]

Vazquez-Anon, M., S. J. Bertics, M. Luck, R. R. Grummer, and J. Pinheiro. 1994. Peripartum liver triglyceride and plasma metabolites in dairy cows. J. Dairy Sci. 77:1521–1528.[Abstract]

Watterau, J. R., M. C. M. Lin, and H. Jamil. 1997. Microsomal triglyceride transfer protein. Biochim. Biophys. Acta 1345:136–150.[Medline]


This article has been cited by other articles:


Home page
J DAIRY SCIHome page
K. Duske, H. M. Hammon, A.-K. Langhof, O. Bellmann, B. Losand, K. Nurnberg, G. Nurnberg, H. Sauerwein, H. M. Seyfert, and C. C. Metges
Metabolism and lactation performance in dairy cows fed a diet containing rumen-protected fat during the last twelve weeks of gestation
J Dairy Sci, April 1, 2009; 92(4): 1670 - 1684.
[Abstract] [Full Text] [PDF]


Home page
J DAIRY SCIHome page
P. Rezamand, T. A. Hoagland, K. M. Moyes, L. K. Silbart, and S. M. Andrew
Energy Status, Lipid-Soluble Vitamins, and Acute Phase Proteins in Periparturient Holstein and Jersey Dairy Cows With or Without Subclinical Mastitis
J Dairy Sci, November 1, 2007; 90(11): 5097 - 5107.
[Abstract] [Full Text] [PDF]


Home page
J DAIRY SCIHome page
N. Lacetera, U. Bernabucci, D. Scalia, L. Basirico, P. Morera, and A. Nardone
Heat Stress Elicits Different Responses in Peripheral Blood Mononuclear Cells from Brown Swiss and Holstein Cows
J Dairy Sci, December 1, 2006; 89(12): 4606 - 4612.
[Abstract] [Full Text] [PDF]


Home page
J DAIRY SCIHome page
U. Bernabucci, L. Basirico, N. Lacetera, P. Morera, B. Ronchi, P. A. Accorsi, E. Seren, and A. Nardone
Photoperiod Affects Gene Expression of Leptin and Leptin Receptors in Adipose Tissue from Lactating Dairy Cows
J Dairy Sci, December 1, 2006; 89(12): 4678 - 4686.
[Abstract] [Full Text] [PDF]


Home page
J DAIRY SCIHome page
N. Lacetera, D. Scalia, U. Bernabucci, B. Ronchi, D. Pirazzi, and A. Nardone
Lymphocyte Functions in Overconditioned Cows Around Parturition
J Dairy Sci, June 1, 2005; 88(6): 2010 - 2016.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bernabucci, U.
Right arrow Articles by Nardone, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bernabucci, U.
Right arrow Articles by Nardone, A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS