|
|
||||||||
1 Dipartimento di Produzioni Animali, Università della Tuscia-Viterbo, Italy
2 Sezione di Medicina Veterinaria Interna, Università di Perugia, Italy
Corresponding author: U. Bernabucci; e-mail: bernad{at}unitus.it.
| ABSTRACT |
|---|
|
|
|---|
Key Words: apolipoprotein B apolipoprotein E mRNA liver
Abbreviation key: ApoB100 = apolipoprotein B100, ApoE = apolipoprotein E, GAPDH = glyceraldehyde-3-phosphate dehydrogenase, HDL = high density lipoprotein, LDL = low density lipoprotein, MTP = microsomal triglyceride transfer protein, RT-PCR = reverse transcription-polymerase chain reaction, TG = triglyceride, VLDL = very low-density lipoprotein
| INTRODUCTION |
|---|
|
|
|---|
Regulation of tissue-specific gene expression is of great interest. Its study is possible using RNA as a parameter of gene expression (Farrell, 1998). Messenger-RNA biogenesis, maturity, and function are influenced transcriptionally and posttranscriptionally and together constitute myriad regulation control points within the cell.
Therefore, a trial was conducted to assess liver gene expression of ApoB100, ApoE, and MTP, the 3 main proteins involved in the VLDL assembly and secretion in liver, and to evaluate the relationship between their expression and metabolic status in periparturient dairy cows to get a better understanding of what may be limiting VLDL secretion.
| MATERIALS AND METHODS |
|---|
|
|
|---|
|
During the experimental period body condition of cows was scored by one person weekly following the method of ADAS (1986). Blood samples were taken at 0800 h from the jugular vein at 35, 27, 20, 12, and 4 prepartum (before expected calving) and at 3, 10, 17, 24, 30, and 35 postpartum. Blood samples were collected in Vacutainer tubes containing Li-heparin as anticoagulant agent and put in ice. Blood was centrifuged at 2700 xg for 10 min at 4°C. Aliquots of plasma were stored at 20°C until analyzed for glucose, cholesterol, and albumins (kits from Instrumentation Laboratory, Lexington, MA), BHBA (Barnouin et al., 1986) and NEFA (NEFA-C kit; Wako Fine Chemical Industries USA, Inc., Dallas TX). On d 35, 3, and 35 relative to day of calving blood samples were collected in Vacutainer tubes without anticoagulants. Serum was obtained by centrifuging blood at 2700 xg for 10 min at 4°C. Very low density, low density (LDL), and high density (HDL) lipoproteins were separated on agarose gel (Hydragel Lipo+Lp(a), Sebia Electrophoresis, Norcross, GA) and the relative quantification was done by densitometric scanning (Contois et al., 1999). The assay is based on the separation of HDL, LDL, and VLDL on agarose gels, followed by enzymatic cholesterol staining (Contois et al., 1999).
Liver biopsies (Vazquez-Anon et al., 1994) were performed on d 35, 3, and 35 relative to day of calving after first locating the liver by ultrasound. The biopsy samples were obtained from the right lobe of the liver inserting the needle through the 10th or 11th intercostal space.
Immediately after collection, liver samples were rinsed in RNase-free water (diethyl-pyrocarbonate-treated water), frozen in liquid nitrogen, and stored at 80°C until the ribonuclease protection assay of ApoB100, ApoE, and MTP mRNA (Ilian et al., 1999).
Quantification of ApoB100, ApoE, and MTP mRNA by Ribonuclease Protection Assay
Isolation of total RNA from liver tissue.
Total RNA was isolated by homogenizing biopsies (50 to 100 mg of liver tissue) in 1 mL of TRI reagent solution containing phenol and guanidinium thiocyanate (Sigma-Aldrich, Milan, Italy) following the procedure described by the manufacturer. The homogenate was incubated in 100 µL of 2 M Na-acetate (pH 4) and 200 µL of chloroform:isoamyl-alcohol, incubated in ice for 15 min. After incubation, the mixture was centrifuged at 14,000 xg for 15 min at 4°C. Following centrifugation, to precipitate RNA, the colorless aqueous phase was transferred to a fresh tube and an equal volume of ice cold isopropanol was added. The mixture was incubated at 20°C for 1 h. After incubation, the mixture was centrifuged at 14,000 xg for 15 min at 4°C, the pellet was washed twice with 75% ethanol by centrifugation at 14,000 xg for 5 min at 4°C. The pellet was redissolved in RNase-free water and incubated for 10 min at 55°C. Total RNA was quantified by measuring its absorbance at 260 nm. To verify integrity, cellular RNA (10 µg) was electrophoresed on 1.2% agarose2.2% formaldehyde denaturing gel in 1 x MOPS [3-(n-morpholino)propanesulfonic acid] and stained with ethidium bromide. Cellular RNA that had intact 28S and 18S ribosomal bands were used in subsequent analyses. Isolated RNA was stored at 80°C until the ribonuclease protection assay.
Synthesis of RNA probes of human ApoB100, bovine ApoE, MTP, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH).
Specific antisense ribonucleotide probes were generated using cDNA of ApoB100, ApoE, MTP, and GAPDH, which was used as internal control, that were produced from bovine liver RNA by reverse transcription-polymerase chain reaction (RT-PCR).
The MTP RNA probe-oligonucleotide primers of MTP used for RT-PCR (forward: 5'-AGACTGAAGCCAGGA AAGCA-3'; reverse: 5'-TAATACGACTCACTATAGGG AGTGA GCAGAGGTGACAGCATC-3') were designed from the bovine MTP cDNA. The reverse transcription reaction mixture (Superscript, II, GIBCO-BRL, Life Technologies, Gaithersberg, MD), and 200 U of Superscript II RNase H-reverse transcriptase (GIBCO-BRL, Life Technologies), were incubated at 70°C for 10 min. The subsequent reverse transcription reaction was carried out at 42°C for 50 min. Polymerase chain reaction was used to amplify a 305-bp MTP cDNA fragment. The total PCR reaction mixture of 100 µL contained 5 U of Taq DNA polymerase (GIBCO-BRL, Life Technologies). To check for specificity, PCR products were analyzed by 1% agarose gel electrophoresis, TBE buffer (0.89 M Tris, 0.89 M boric acid, 20 mM EDTA, pH 8.2) and 0.5 µg/mL of ethidium bromide.
The ApoB100 RNA probe, a 378-bp ApoB100 cDNA, was produced by using procedures similar to those described for MTP. Oligonucleotide primers of ApoB100 used for RT-PCR (forward: 5'-GCAAGGAGCAACACCTCTTC-3'; reverse: 5'-TAATACGACTCACTATAGGGAGGTCCACACTGAACCAAGGTC-3') were designed from the human ApoB100 cDNA.
The ApoE RNA probe, a 265-bp ApoE cDNA, was synthesized as described above for MTP. Oligonucleotide primers of ApoE used for RT PCR (forward: 5'-AT GAAGGTTCTGTGGGTTGC-3'; reverse: 5'-TAATACG ACTCACTATAGG GAGATGAAGGTTCTGTCGGTTG C-3') were designed from the bovine ApoE cDNA.
The GAPDH RNA probe, a 177-bp GAPDH cDNA, was amplified by using 2 synthetic oligonucleotide primers (forward: 5'-TCATCCCTGCTTCTACTGGC-3'; reverse: 5'-TAATACGACTCACTATAGGGAGCCTGCTTCACCACCT TCTTG-3') from the bovine GAPDH cDNA.
The PCR products, containing sequence of the T7 promoter at the 5' end, were transcribed in vitro directly using a Maxiscript transcription Kit (Ambion, Inc., Austin, TX) according to the manufacturers instructions. The reaction mixture contained: 1 µg of template DNA, 2 µL of 10 x transcription buffer, 1 µL of 10 mM ATP, CTP, GTP, UTP, and finally 2 µL of T7 RNA polymerase. Transcription was carried out at 37°C for 60 min. The DNA template was digested with DNase I for 15 min at 37°C. After transcription, all riboprobes were purified by electrophoresis on a 5% TBE-8 M urea acrylamide gel. The product bands were visualized by staining in 2 µg/mL acridine orange in nuclease-free water for 15 min, excised from the gel and eluted passively from gel slices in 0.5 M ammonium acetate, 1 mM EDTA and 0.2% SDS overnight. Following EtOH precipitation, the RNA probes were resuspended in H2O and quantitated by checking the absorbance reading at 260 nm.
The purified riboprobes were labeled with biotin using Brightstar Psoralen-Biotin Kit (Ambion, Inc.) according to the manufacturers instructions. The labeling was carried out by mixing the riboprobes with the Psoralen-Biotin reagent in a microtiter plate and exposing to long wavelength (365 nm) UV light. The Psoralen-Biotin reagent became covalently linked to the riboprobes in 45 min. Any excess Psoralen-Biotin reagent was removed by butanol extraction, and the probe was stored at 80°C until use.
Ribonuclease protection assay.
Hybridization of total RNA with riboprobes was performed using the protocol and reagents supplied in the RPA III kit (Ambion, Inc.) as described for the standard procedure. Target RNA samples (10 µg) and riboprobes (approximately 1 ng per riboprobe) were coprecipitated with ammonium acetate (0.5 M) and ethanol. Yeast RNA from the RPA III kit (10 µg/2 µL) was used as negative control. The RNA samples and riboprobes were subsequently processed following the procedure described by the manufacturer (Ambion, Inc.). The samples were dissolved in hybridization buffer and incubated overnight at 56°C. Unhybridized probes and RNA were digested by RNase A/T1 mixture in digestion buffer for 30 min at 37°C. The digestion was stopped by adding cold inactivation/precipitation solution. The mixture was then incubated at 20°C for 1 h and centrifuged at 14,000 xg for 15 min at 4°C.
The samples were dissolved in gel loading buffer, boiled for 3 min, placed in ice, and loaded on 5% acrylamide gel containing 8 M urea in 1 x TBE. Gel electrophoresis was performed at 250 V for 1 h in a Hoefer model SE 600 gel apparatus (Hoefer Amersham Pharmacia Biotech, UK). The mRNA was then electrophoretically transferred to a positively charged nylon membrane (BrightStar-Plus) in a TE42 Transphor transfer unit (Hoefer Amersham Pharmacia Biotech) with 0.1 x TBE for 45 min at 100 mA.
For the quantitative analysis of MTP, ApoB100, and ApoE mRNA known amounts of in vitro synthesized MTP, ApoB100, ApoE sense RNA were hybridized with an excess of labeled antisense probes to construct the standard curves. Figure 1
reports the standard curve constructed for MTP.
|
Densitometry.
Chemiluminescent films were analyzed with the Kodak EDAS-290 densitometer and ID Image Analysis software (Eastman Kodak Co.). Samples were analyzed in conjunction with the standard curve and the intensity of the probe fragments protected by specific mRNA from the target samples was compared to the standard curve to determine the absolute amounts of ApoB100, MTP, and ApoE mRNA.
Statistical Analysis
Data were analyzed as repeated measures using the MIXED procedure of SAS (SAS, 1999) according to the following model:
![]() |
where
| Yij | = | dependent variable
| µ | = | overall mean of the population
| Di | = | mean effect of day of sampling (i = 1,...3 for MTP, ApoB100, and ApoE; i = 1,...11 for BCS, and metabolic parameters); and
| eij | = | unexplained residual element assumed to be independent and normally distributed.
|
Data were analyzed across sampling days relative to day of calving with d 0 representing the day of calving. For each analyzed variable, cow was subjected to 3 covariance structures: compound symmetric, autoregressive order one, and unstructured covariance. The covariance structure that had the largest Akaikes information criterion and Schwarzs Bayesian criterion was considered the most desirable analysis. For all parameters tested the best covariance structure was compound symmetric. Comparisons for the time factor was made only if the F-test was significant. Least square means were separated with the PDIFF procedure of SAS (1999). Correlation coefficients among different variables were determined by the CORR procedure of SAS (SAS, 1999). Significance was declared at P < 0.05 and trends at P < 0.10.
| RESULTS |
|---|
|
|
|---|
|
Plasma albumin showed a decrease (P < 0.05) subsequent to calving and recovered 3 to 4 wk after calving (Table 2
). Cholesterol started to decrease (P < 0.05) about 2 wk before calving reaching the minimum value 3 d after calving, then increased until the end of the trial (Table 2
). Relative proportion of serum VLDL was lower (P < 0.01) and HDL was higher (P < 0.05) after calving. The LDL did not significantly change during the transition period (Figure 2
).
|
During transition period gene expression of all proteins tested showed significant changes (Figure 3
). The MTP mRNA abundance showed the highest values (P < 0.05) 3 d after calving and the lowest values (P < 0.05) at 35 DIM. ApoB100 mRNA showed lower values (P < 0.05) after calving, and no significant difference was found between values observed at 3 and 35 d postpartum. The gene expression of ApoE was higher after calving and showed the highest values 3 d postpartum.
|
|
| DISCUSSION |
|---|
|
|
|---|
In contrast, with data reported by Rhoads et al. (2003) we did not find any effect of the physiological phase on GAPDH gene expression during the transition period.
In the present study we found an increase of MTP mRNA abundance after calving and no relationships between MTP mRNA and metabolic parameters were detected. Bremmer et al. (2000a) reported a significant increase of MTP mRNA 2 d after calving, in agreement with our results, and no relationships between MTP activity, mass or mRNA with plasma NEFA or liver TG concentration. In a second study, Bremmer et al. (2000b) evaluated the effects of nutritional and hormonal status on gene expression, protein mass, and activity of MTP in nonlactating Holstein cows and in bovine primary cultured hepatocytes. Results of that study suggested that hepatic MTP mRNA may be affected by TG accumulation, insulin, and glucagon in vitro, but the same treatments did not affect MTP mass or activity. Data of our study and data from Bremmer et al. (2000a) clearly demonstrated the up-regulation of MTP gene expression in the early postpartum period. In agreement with conclusion of Bremmer et al. (2000a, 2000b), MTP probably does not play a critical role in the etiology of fatty liver that occurs in dairy cows at calving.
Studies support the concept that ApoB100 secretion is metabolically regulated (Adeli et al., 1995). In studies carried out on laboratory animals and on cultured hepatocytes various metabolic states such as food deprivation and carbohydrate overload and FFA or insulin alter or modulate the level of ApoB100 secretion without any modification of the ApoB100 mRNA level (Adeli et al., 1995; Gruffat et al., 1996). Serum ApoB100 concentration was decreased in cows with fatty liver induced by ethionine (Uchida et al., 1992) and those with natural fatty liver (Marcos et al., 1990b). Katoh (2002) reviewed a decrease of serum ApoB100 concentration in cows with ketosis, left displacement of abomasums, retained placenta, milk fever, and downer syndrome. This author concluded that the decrease of serum ApoB100 concentration in cows with health problems are primarily attributable to fatty liver. In contrast, Mazur et al. (1992) reported that an impaired synthesis of ApoB100 may result in its decreased availability for lipoprotein formation and in turn results in enhanced triglyceride accumulation.
In the lactation cycle, serum ApoB100 concentration is low during early lactation (Marcos et al. 1990a; Gruffat et al., 1997). Gruffat et al. (1997) found a reduction of hepatic ApoB100 concentration in lactating cows at 1, 2, and 4 wk after calving compared with pregnant nonlactating cows and cows at 12 wk in milk. In contrast, the same authors reported that hepatic concentration of ApoB100 mRNA did not vary significantly during early lactation and that it was not statistically different when compared with data of pregnant nonlactating cows. Those authors hypothesized that ApoB100 synthesis during early lactation is regulated posttranscriptionally by either decreased translation or increased rate of intracellular proteolytic degradation. Results obtained from laboratory animals and humans indicated that among different possible mechanisms operating in mammals, intracellular translation of ApoB100 mRNA and degradation of ApoB100 are more likely to be the key regulatory mechanisms controlling the acute regulation of ApoB100 production by the liver (Adeli et al., 1995). In contrast, the exact mechanism for the depression in both circulating and hepatic reduction of ApoB100 concentration in the early postpartum period of dairy cows is not known yet.
Gruffat-Mouty et al. (1999) measured hepatic ApoB synthesis and VLDL secretion in ruminant and rodent liver cells and concluded that the slow rate of secretion of VLDL in calf liver cells was not consecutive to a low rate of synthesis of ApoB but rather to a defect in VLDL assembly and/or secretion. Marcos et al. (1990b) reported that the level of liver ApoB mRNA in fatty liver cows was lower than in control cows and concluded that hepatic apolipoprotein synthesis is impeded in fatty liver cows.
Even though Gruffat et al. (1997) reported nonstatistical differences between early lactating and pregnant dry cows, ApoB100 mRNA in lactating cows 1 wk after calving was 67% of that registered in pregnant dry cows. We found a significant decrease of ApoB100 mRNA abundance after calving (27%) compared with data before calving and no statistical difference was found during lactation (Figure 3
). Changes of ApoB100 mRNA abundance and relationships between ApoB100 mRNA and plasma NEFA, cholesterol and albumins observed in the present study, would indicate a possible regulation at transcriptional level of ApoB100 in the early postpartum period other than at posttranscriptional level as exclusively suggested by Gruffat et al. (1997).
To our knowledge, no data are available on changes of ApoE mRNA in periparturient dairy cows. Recent studies demonstrated that in ApoE-deficient mice VLDL-triglyceride secretion was severely impaired and mice developed fatty liver (Mensenkamp et al., 2001). Those authors have established the implication of ApoE in lipoprotein clearance and in the regulation of lipoprotein secretion by the liver, even though the exact mechanism is not clear yet. The upregulation of ApoE gene expression in the early postpartum, found in the present study, might be explained by the response of hepatocytes to the increased TG availability for VLDL synthesis. Considering our results and finding of Takahashi et al. (2003a, b), ApoE might be excluded as the possible factor implicated in the etiology of fatty liver at calving.
| CONCLUSIONS |
|---|
|
|
|---|
The mechanism by which ApoB100 gene expression is downregulated and MTP and ApoE are upregulated in the early postpartum was not established.
| FOOTNOTES |
|---|
Received for publication January 12, 2004. Accepted for publication March 3, 2004.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
P. Rezamand, T. A. Hoagland, K. M. Moyes, L. K. Silbart, and S. M. Andrew Energy Status, Lipid-Soluble Vitamins, and Acute Phase Proteins in Periparturient Holstein and Jersey Dairy Cows With or Without Subclinical Mastitis J Dairy Sci, November 1, 2007; 90(11): 5097 - 5107. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Lacetera, U. Bernabucci, D. Scalia, L. Basirico, P. Morera, and A. Nardone Heat Stress Elicits Different Responses in Peripheral Blood Mononuclear Cells from Brown Swiss and Holstein Cows J Dairy Sci, December 1, 2006; 89(12): 4606 - 4612. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Bernabucci, L. Basirico, N. Lacetera, P. Morera, B. Ronchi, P. A. Accorsi, E. Seren, and A. Nardone Photoperiod Affects Gene Expression of Leptin and Leptin Receptors in Adipose Tissue from Lactating Dairy Cows J Dairy Sci, December 1, 2006; 89(12): 4678 - 4686. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Lacetera, D. Scalia, U. Bernabucci, B. Ronchi, D. Pirazzi, and A. Nardone Lymphocyte Functions in Overconditioned Cows Around Parturition J Dairy Sci, June 1, 2005; 88(6): 2010 - 2016. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |