| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
1 Institute of Physiology, Biochemistry and Animal Hygiene, University of Bonn 53115, Germany
2 Institute of Physiology Weihenstephan, Technical University, Munich 85350, Germany
Corresponding author: S. Hiss; e-mail: s.hiss{at}uni-bonn.de.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGEMENTSREFERENCES |
|---|
Key Words: mammary gland • haptoglobin • mastitis • dairy cow
Abbreviation key: APP = acute phase protein, bHp = bovine haptoglobin, CRP = C-reactive protein, Hp = haptoglobin, OD = optical density
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGEMENTSREFERENCES |
|---|
The aim of this study was to develop an ELISA that is sufficiently sensitive to determine Hp concentrations in both serum and milk under basal conditions as well as during inflammation. This test was applied to milk and serum samples from cows following experimentally induced sterile mastitis. The results led to the hypothesis that Hp might not only be transferred from blood into milk but could also be locally synthesized within the mammary gland. For this reason, we evaluated whether Hp mRNA is detectable in mammary gland tissue extracts and whether LPS-induced alterations of the expressions might be observed.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGEMENTSREFERENCES |
|---|
Generation of polyclonal antibodies against bHp.
An amount of 200 µg of purified bHp was emulsified in Freund’s complete adjuvant (Sigma Aldrich, Taufkirchen, Germany) and injected subcutaneously into rabbits at multiple sites. For subsequent immunizations, 50 or 100 µg of purified bHp in Freund’s incomplete adjuvant (Sigma Aldrich) were used. One week after each booster injection, the rabbits were bled from an ear vein. Blood was allowed to clot at room temperature, and after centrifugation (2000 x g), aliquots of antiserum were stored at –20°C. Titers and binding specificity were tested by ELISA and Western blotting as described below, and the antiserum with the highest titer was selected for use.
Western immunoblotting.
Electrophoresis was performed as described above. In addition to the bHp preparation, bovine and caprine serum from clinically healthy animals and also serum from a cow with acute mastitis were used in SDS-PAGE. Acrylamide gels from electrophoresis were electro-blotted onto PVDF membranes (Hybond-P, Amersham Biosciences, Freiburg, Germany), and membranes were then blocked with 2.5% casein for 20 min. The rabbit antibHp serum was diluted 1/10,000 in assay buffer (0.12 M NaCl, 0.02 M Na2HPO4, 0.01 M EDTA, 0.1% hydrolyzed gelatin, 0.005% chlorhexidine digluconate 20%, 0.05% Tween 20, 0.002% phenol red, pH 7.4) containing 0.5% casein. After incubation for 1 h, the membrane was washed in assay buffer and incubated with the second antibody conjugated to peroxidase (monoclonal antirabbit IgG, 
-chain specific, Sigma Aldrich) for 30 min (dilution 1/10,000). After 3 washes with washing buffer (10% PBS, pH 7.4, 0.05% Tween 20), the substrate (3,3'-diaminobenzidin-tetrahydrochloride) was added. The reaction was stopped with distilled water.
Development of the bHp ELISA.
Microtiter plates (EIA plate 9018, Corning Costar, Cambridge, MA) were coated with purified bHp (5 ng in 100 µL of 50 mM NaHCO3, pH 9.6) at 4°C for 20 h. After blocking with 300 µL of 2.5% casein in 0.05 M NaCl, pH 7.4, at room temperature for 1.5 h, the plates were stored at –20°C. Prior to use, the plates were washed 5 times. To each well, 50 µL of test sera (dilution 1/100 in healthy cows or 1/1000 in diseased cows) was added in duplicate. For Hp quantification in milk, skim milk was used accordingly (dilution 1/10 or 1/100). Calibration curves were created using 50 µL of purified bHp at dilutions from 0.0 to 10 µg/mL in duplicate. An amount of 50 µL of the antiserum (dilution 1/50,000) was then added and incubated for 2 h at room temperature. After 3 washes, 100 µL of the second antibody conjugated to peroxidase (1/20,000 dilution) was added and incubated for 30 min. After 5 washes, the wells were filled with 150 µL of a freshly prepared substrate solution containing 0.05 M citric acid, 0.055 M Na2HPO4, 0.05% urea hydrogen peroxide, 2% ProClin 150, and 2% of a tetramethylbenzidine solution (12.5 mg/mL dimethylsulfoxide). The reaction was stopped after 30 min with 50 µL of 1 M oxalic acid, and the optical density (OD) was determined at 450 nm with a microtiter plate reader (ELX800, Bio-Tec Instruments, Inc., Winooski, VT). The Hp concentrations in unknown samples were then calculated from the calibration curve.
Twenty-nine serum samples were analyzed for their Hp content by the ELISA developed herein and also by the haptoglobin phase kit (Tridelta Development Ltd., Greystones, Ireland) based on the hemoglobin-binding capacity according to the manufacturer’s instructions.
Animals, Treatments, and Sample Collection
To evaluate the presence and distribution of Hp mRNA in the bovine mammary gland, tissue samples were collected from 4 lactating dairy cows at a local slaughter house. Tissue cubes of approximately 0.5 cm3 in size were dissected from the liver, the teat, from the cisternal region containing the large milk duct epithelia, and from the glandular parenchyma. Samples for the qualitative analysis were frozen in dry ice.
Endotoxin-induced alterations of milk and mammary Hp mRNA were investigated in 2 animal experiments. Both experiments were approved by the Animal Ethics committee of Bavaria. For experiment one, 6 healthy lactating cows in their first to fourth lactation (4 German Simmental and 2 Brown Swiss) milking an average of 19 kg/d were used. The cows were transferred to the experimental stable and were then allowed to get accustomed to the new environment. Quarter milk samples were collected daily for microbiological testing and for determinations of milk SCC. Only quarters with SCC below 150,000 cells/mL and with milk free of mastitis pathogens were used for the studies. All animals were injected with oxytocin (30 I.U. i.m.) after each machine milking (every 12 h), and the residual milk was subsequently milked out by machine. On the day of the experiment, one quarter per cow was randomly assigned to treatment, and the contralateral quarter was assigned to control. An amount of 100 µg of Escherichia coli-LPS (serotype O26:B6; Sigma Chem. Co., St. Louis, MO) in 10 mL of saline was injected into the teat cistern of the treatment quarter. The control quarter was injected with 10 mL of saline. Mammary biopsies were obtained immediately before (0 h) and 3, 6, 9, and 12 h after the LPS injections, as described in detail by Schmitz et al. (2004). In brief, the skin of the selected biopsy site was disinfected with ethanol (70%), anaesthetized with Xylocain spray (AstraZeneca, Wedel, Germany), and injected subcutaneously with 1 mL of lidocain (Chassot, Ravensburg, Germany). A 1- to 1.5-cm incision was made through the skin and the connective tissue capsule using shears and tweezers, and the secretory tissue was exposed. Biopsies were then taken using a BardMagnum Biopsy instrument (Bard, Covington, GA) with a 12-g x 10-cm biopsy needle (Bard, Covington, GA). At each sampling time, 2 cores of mammary tissue (30 to 60 mg) were collected through the initial incision, but the entrance angle of the needle was changed to obtain tissue from areas not sampled previously. The biopsy samples were immediately snap-frozen in liquid nitrogen and stored at –80°C until used for mRNA analyses. The incision wound was dressed between the biopsy procedures. Immediately after the experiment, all animals received antibiotic prophylaxis and anti-inflammatory therapy. The wound dressings were changed daily until healing. During the experiment and the 3 d of postexperimental treatments, the cows were not milked.
The biopsy procedure lead to visible alterations of the milk with blood impurities. To obtain normal milk for measurements of the Hp protein, a separate experiment with another 6 cows (6 Brown Swiss, first to fifth lactation) was performed. The experimental setup for experiment 2 was basically the same as for experiment 1, but only quarter milk samples were collected for determinations of SCC and Hp at 0, 3, 6, 9, 12, 24, 48, and 60 h after challenge from the infected and from the control quarters. Besides the milk samples that were taken, cows were milked every 12 h. In addition, blood samples for Hp determination were collected 0, 3, 6, 9, and 12 h after LPS administration from the jugular vein.
Qualitative mRNA Analysis
Total RNA extraction from liver and mammary tissues from slaughtered cows was done according to the guanidinium thiocyanate method (Chomczynski and Sacchi, 1987). The total RNA extracted was treated with DNase I, RNase free (Boehringer, Mannheim, Germany) according to the manufacturers’ instructions. The enzyme was then heat-inactivated for 5 min at 75°C. Concentration of total RNA in each sample was quantified by absorbance readings at 260 nm, and the integrity of the RNA was checked by ethidium bromide staining after formaldehyde gel electrophoresis. An amount of 1.8 µg total RNA was reverse transcribed using 200 U reverse transcription (MBI Fermentas, St. Leon Rot, Germany) in reaction buffer (50 mM Tris-HCl, 50 mM KCl, 4 mM MgCl2, pH 8.3) with 10 mM DTT, 50 pmol of random hexamer primers (Invitrogen, Karlsruhe, Germany), 500 µM of dNTPs, and 20 U of ribonuclease inhibitor (MBI Fermentas) in a 20-µL volume for 10 min at 27°C, 60 min at 42°C, and 1 min at 99°C to inactivate the reverse transcription. Negative controls were performed in the absence of total RNA.
Polymerase chain reaction was done with 3 µL of cDNA synthesis-product, forward primer 5'GTCTCCCAGCATAACCTCATCTC 3'and reverse primer 5'AACCACCTTCTCCACCTCTACAA 3 ' (20 pmol of each) spanning the region 33 to 207 bp of the partially published cDNA sequence of bHp (NIH Gen-Bank accession no.: AJ271156), 1 U of Taq DNA-polymerase (MBI Fermentas) in a final volume of 50 µL with 75 mM Tris-HCl, 2 mM MgCl2, 20 mM (NH4)2SO4, 0.01% Tween 20, pH 8.8, according to the following temperature-time protocol: 95°C for 60 s, 32 cycles of 94°C for 40 s, 55°C for 20 s, 72°C for 20 s, and final extension at 72°C for 5 min. An amount of 10 µL of the amplified products was analyzed on a 2% agarose gel by ethidium bromide staining (FluorImager SI, Amersham Pharmacia Biotech, Uppsala, Sweden). The specificity of the resulting 174-bp DNA fragment was verified by direct sequencing of the PCR product (Pharmiss, Bonn, Germany).
Quantitative mRNA Analysis
Total RNA of mammary biopsy samples was isolated using TriPure (Roche Diagnostics, Mannheim, Germany) according to the manufacturer’s recommendations. To quantify the amount of total RNA extracted, OD was determined at 3 dilutions of the final RNA preparations at 260 nm. Synthesis of cDNA was performed with reverse transcription (MMLV-RT, Promega, Madison, WI) and random hexamer primers (MBI Fermentas) according to the manufacturer’s instructions. Polymerase chain reaction was performed in the LightCycler (Roche Diagnostics, Mannheim, Germany) with 25 ng of reverse transcribed total RNA. Primers were as described above for qualitative analyses. The other components used for the LightCycler reactions were 1.0 µL of LightCycler DNA Master SYBR Green I (Roche Diagnostics), 1.2 µL of MgCL2 (4 mM), 0.2 µL of forward primer (0.4 µM), 0.2 µL of reverse primer (0.4 µM), and water to a final volume of 10 µL. Prior to the amplification, an initial denaturation step was performed to ensure complete denaturation of cDNA. For the amplification, the same temperature-time protocol as described for the qualitative approach above was used. To each amplification cycle, a fourth segment with an elevated temperature fluorescence acquisition point was added to remove unspecific signals before SYBR Green I quantification, thus permitting a more specific quantification of PCR products. After the last amplification cycle, the PCR product was specified in a melting curve analysis by its specific melting temperature.
To confirm a constant housekeeping gene expression level in the RNA extracts derived from the different biopsies, ubiquitin expression was analogously quantified by real time-PCR as described earlier (Schmitz et al., 2004).
Mathematical Evaluation of Hp mRNA Expression
A relative quantification normalized to an assumed constant ubiquitin mRNA expression was performed. For the determination of the expression, the crossing point (CP) values obtained by the LightCycler software (3.1) based on the Fit Point method fluorescence acquisition were used for calculations. In each ideal PCR cycle, the number of copies of a cDNA strand doubles. Thus, a change of the crossing point result of 1 means a change of the product by factor 2, i.e., the crossing point represents the logarithm dualis of the amount of cDNA. Calculations were described previously in detail by Schmitz et al. (2004). To eliminate pretreatment variation between samples and to visualize changes with time, the CP results of repeated biopsy samples were subtracted from the CP value determined for the 0-h biopsy. Data are presented as mean ± SEM.
Statistical Analysis
All statistical analyses were performed with the SPSS/PC 10.0 program. Nonparametric correlation coefficients (Spearmen) were determined to compare Hp concentrations in blood and milk and also to compare the 2 different Hp tests. Changes in Hp concentrations in blood and milk as well as increased mRNA levels compared with baseline levels were tested using the Wilcoxon 2 sample paired signed rank test. Differences in Hp mRNA expression between control quarters and infected quarters were analyzed using repeated measurement analyses (general linear model). Where applicable, Hp concentrations are given as means ± SEM.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGEMENTSREFERENCES |
|---|
). A polyclonal antiserum against the purified bHp was successfully raised, and its specificity was demonstrated by Western blotting (Figure 1B). Positive signals at 34 kDa and at 18 kDa, corresponding to the heavy and light chain, were obtained both from electrophoresed bovine serum (acute mastitis) as well as from the purified Hp preparation. There was no signal in serum from clinically healthy animals (cow and goat).
|
). The limit of detection (0.07 µg/mL) was estimated as the mean plus 2 standard deviations of 20 zero samples (blanks). Intra- and interassay coefficients of variation were 3.9% (n = 8) and 12.16% (n = 13), respectively. Compared with the commercial haptoglobin phase kit (Tridelta Development Ltd.), the concentrations measured by ELISA were correlated (n = 29, r = 0.75, P < 0.01).
|
). Mean pretreatment values of Hp in blood were 25-fold higher than in milk. In serum, the first significant increase was observed 9 h after injection of LPS (P < 0.05). The mean concentrations reached after 12 h were 11.2-fold higher when compared with the initial basal concentration. Haptoglobin concentrations in milk obtained from the quarter used as control remained unchanged. In milk samples obtained from the treated quarter, increased Hp concentrations after 3 h were 35-fold higher than the pretreatment levels (P < 0.05). Maximal Hp concentrations of more than 160-fold above basal concentrations were maintained until 12 h after LPS injection.
|
).
|
, maximal Hp mRNA expression values were reached after 6 h in LPS-treated quarters (P < 0.05). The increase in the control quarters was less pronounced, reaching maximum levels after 9 h (P < 0.05).
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGEMENTSREFERENCES |
|---|
The early increase of the Hp concentration in milk in our own studies lead us to hypothesize that Hp may be synthesized locally in the mammary gland and thus not limited to changes in the permeability of the blood milk barrier as suggested by Eckersall et al. (2001). The extrahepatic synthesis of Hp has not been reported in cattle so far, although there are reports of Hp mRNA expression in adipocytes in LPS-treated mice (Friedrichs et al., 1995). The evidence of Hp mRNA that we observed in mammary gland tissues (the teat, the cisternal region, and the glandular parenchyma) supports the notion that the bovine mammary gland can be considered as another extrahepatical source of Hp. In addition, the demonstration of the LPS-induced upregulation of Hp mRNA strongly indicates that mammary Hp expression is stimulated by proinflammatory stimuli as it is in the liver. The relatively small increase of Hp mRNA we observed in the control quarters is probably due to a locally induced acute phase response as a result of the biopsy procedure itself, as suggested by Schmitz et al. (2004). The authors reported similar increases and relations between control quarters and treated quarters for the proinflammatory cytokine tumor necrosis factor alpha.
The cellular localization of Hp expression in the mammary gland is not known yet, but migrated leukocytes might contribute or solely account for the Hp mRNA detected. In humans, Hp is concentrated within granulocytes; however, Hp gene transcription in granulocytes is negative, as shown by northern blotting analysis (Wagner et al., 1996). Only few data are available on the expression of other APP in the mammary gland. Eckersall et al. (2001) suggested that there might be a local synthesis of serum amyloid A during mastitis. This is supported by reports on the expression of mammary-associated serum amyloid A3 (McDonald et al., 2001) and mammary serum amyloid A3 homologue (Molenaar et al., 2002). Molenaar et al. (2002) reported high levels of serum amyloid A3 homologue mRNA in ductal epithelial cells and low levels in lactating secretory cells by in situ hybridization.
The biological function of Hp synthesis in the mammary gland during mastitis might be related to the bacteriostatic properties of Hp (Eaton et al., 1982). Haptoglobin blocks the hemoglobin-driven growth of E. coli in mice in vivo by preventing the use of hemoglobin iron. It thus may support or complement the actions of lactoferrin. Nevertheless, it is yet unknown whether Hp is able to prevent iron use in pathogens causing mastitis other than E. coli . Staphylococcus aureus, an important pathogen in bovine mastitis, exhibits multiple iron uptake systems, including hemin (Diarra et al., 2002). Moreover, Neisseria meningitidis, a pathogen in humans, is able to acquire iron from hemoglobin-Hp complexes in vitro (Lewis and Dyer, 1995).
In conclusion, our studies demonstrate that Hp is synthesized within the mammary gland. The LPS-induced increase of Hp mRNA supports a very close link between mastitis and Hp synthesis in mammary tissue and indicates that Hp detectable in milk not only originates from circulation. Using sufficiently sensitive assays as the ELISA we developed, milk Hp measurements may provide an additional tool for the investigation of inflammatory processes in the mammary gland and may also be used as an early diagnostic marker for mastitis.
|
ACKNOWLEDGEMENTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGEMENTSREFERENCES |
|---|
Received for publication September 23, 2003. Accepted for publication June 8, 2004.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGEMENTSREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  S. Hachenberg, C. Weinkauf, S. Hiss, and H. Sauerwein Evaluation of classification modes potentially suitable to identify metabolic stress in healthy dairy cows during the peripartal period J Anim Sci, August 1, 2007; 85(8): 1923 - 1932. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. A. Thielen, M. Mielenz, S. Hiss, H. Zerbe, W. Petzl, H.-J. Schuberth, H.-M. Seyfert, and H. Sauerwein Short Communication: Cellular Localization of Haptoglobin mRNA in the Experimentally Infected Bovine Mammary Gland J Dairy Sci, March 1, 2007; 90(3): 1215 - 1219. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Hyvonen, L. Suojala, T. Orro, J. Haaranen, O. Simola, C. Rontved, and S. Pyorala Transgenic Cows That Produce Recombinant Human Lactoferrin in Milk Are Not Protected from Experimental Escherichia coli Intramammary Infection Infect. Immun., November 1, 2006; 74(11): 6206 - 6212. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Lauzon, X. Zhao, and P. Lacasse Deferoxamine reduces tissue damage during endotoxin-induced mastitis in dairy cows. J Dairy Sci, October 1, 2006; 89(10): 3846 - 3857. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. D. Eckersall, F. J. Young, A. M. Nolan, C. H. Knight, C. McComb, M. M. Waterston, C. J. Hogarth, E. M. Scott, and J. L. Fitzpatrick Acute Phase Proteins in Bovine Milk in an Experimental Model of Staphylococcus aureus Subclinical Mastitis J Dairy Sci, May 1, 2006; 89(5): 1488 - 1501. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. J. Schaer, C. A. Schaer, P. W. Buehler, R. A. Boykins, G. Schoedon, A. I. Alayash, and A. Schaffner CD163 is the macrophage scavenger receptor for native and chemically modified hemoglobins in the absence of haptoglobin Blood, January 1, 2006; 107(1): 373 - 380. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
), blood (
), and milk (•) showing parallelism between standard curve (bHp), blood serum, and skim milk.
174 DNA / BsuRI (HaeIII); L = liver, CR = cisternal region, GP = glandular parenchyma, T = teat, C = control.
) after LPS application (mean ± SEM, n = 6) in relation to ubiquitin expression.