| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
1 Department of Animal Science and
2 College of Veterinary Medicine, Michigan State University, East Lansing 48824
Corresponding author: N. L. Trottier; e-mail: trottier{at}msu.edu.
 |
ABSTRACT |
|---|
 TOP ABSTRACT REFERENCES |
|---|
Key Words: amino acid transporter • mammary gland • lactation • porcine
Abbreviation key: MT = mammary tissue.
Despite the central role of AA transporters in the provision of AA necessary for synthesis of proteins for cell structure, enzymes, and signaling mechanisms (Meyer, 2001), little is known about regulation of AA transport and/or the factors that affect their activity in various tissues. Expression of AA transporter transcripts and proteins known to mediate AA transport in other tissues has not been studied in porcine mammary tissue (MT). Such knowledge is critical to enhance our understanding of the factors controlling milk protein synthesis in lactating sows. Kinetic studies using porcine MT explants have provided indirect evidence that AA transport in MT is specific and carrier-mediated (Jackson et al., 2000; Hurley et al., 2000). This led us to hypothesize that AA transporter proteins CAT-1, CAT-2A, and CAT-2B (system y+); B0,+ (system B0,+); and ASCT1 (system ASC) are present in porcine MT. The objectives were to determine the presence of RNA transcripts for these transporters and quantify their abundance during early (d 7) and peak (d 17) lactation.
Mammary biopsies from randomly selected lactating sows (n = 3) were performed, and tissue was rapidly flash-frozen in liquid nitrogen and stored at –80°C. Liver from a prepubertal gilt was collected following euthanasia and handled in same manner as MT. Liver was collected as a negative control for CAT-1 and CAT-2B and as a positive control for CAT-2A. Total RNA was isolated from liver and MT using TRIzol reagent (Invitrogen Life Technologies) following manufacturer’s instructions as described in Weber et al. (2001).
Human CAT-1, CAT-2A, and CAT-2B cDNA probes were donated by E. Closs (Johannes Gutenberg University, Germany). A 400-bp CAT-2B-specific cDNA probe was developed from the region where human CAT-2A and CAT-2B differ (Closs et al., 1997). To confirm its identity to the human CAT-2B (GenBank Accession number U76369), the DNA fragment was sequenced using a dye-terminator fluorescent cycle sequencing technique and an ABI 3100 Genetic Analyzer (PerkinElmer Applied Biosystems, Foster City, CA). The sequenced fragment was then used to synthesize a 32P-labeled CAT-2B cDNA probe. Porcine B0,+ and ASCT1 cDNA probes were developed by PCR using pooled cDNA from porcine MT as a template. The PCR primers were designed from the published human B0,+ (GenBank Accession number AF151978) and human ASCT1 (GenBank Accession numbers L14595 and L19444) cDNA sequences. Polymerase chain reaction was carried out in a RoboCycler Gradient 96 (Stratagene, La Jolla, CA) using Taq DNA polymerase as recommended by manufacturer (Invitrogen, Life Technologies). Resulting PCR amplification products were visualized as single bands of correct size using agarose gel electrophoresis (1.8% gel), gel purified (Wizard PCR Preps DNA Purification System; Promega, Madison, WI) and ligated into the pGEM-T Easy cloning vector (Promega); recombinant plasmids were transformed into JM109 competent cells (Promega). Prior to radioactive labeling for Northern blot hybridizations, the cloned inserts were excised from purified plasmid DNA using EcoRI, gel purified (Wizard kit; Promega) and visualized as single bright bands on 1.8% agarose checking gels stained with ethidium bromide. The 787 and 373 bp cDNA probes for B0,+ and ASCT1, respectively, were DNA sequenced in both directions to confirm identities using a dye-terminator fluorescent cycle sequencing technique and an ABI 3100 Genetic Analyzer (PerkinElmer Applied Biosystems), and the sequence information was deposited in GenBank (Accession numbers: AY375264 and AY375265).
The CAT-1, CAT-2A, CAT-2B, B0,+, and ASCT1 probes were validated by Northern blot analysis using duplicate aliquots of porcine liver and MT collected as described in Weber et al. (2001). Hybridizations were carried out for 18 to 24 h at 42°C using 32P-labeled cDNA probes (NEN Life Science Products, Inc., Boston, MA) generated by the random prime method (Feinberg and Vogelstein, 1983.). The blot was probed first with ß-actin cDNA to verify equality of RNA loading across lanes, followed by CAT-1, CAT-2A, CAT-2B, B0,+, and ASCT1 cDNA with complete stripping of the blot between hybridizations. Nylon membranes (Amersham Biosciences, NJ) were then washed and exposed to BioMax MS film (Fisher Scientific, Pittsburgh, PA) for 24 to 240 h at –80°C with an intensifying screen (Fisher Scientific).
Figure 1
shows Northern blot validations of CAT-1, CAT-2A, CAT-2B, B0,+ and ASCT1 cDNA probes. Human CAT-1 probe hybridized to a predominant transcript of expected size (~5.2 kb) in MT. The CAT-1 also hybridized to a predominant transcript in liver tissue, which is in contrast to most species studied to date, but in agreement with Liu and Hatzoglou (1998), who also demonstrated the presence of CAT-1 in rat liver. CAT-1 transcript presence in MT has also been demonstrated in sheep (Kiaei, M., M. P. Thompson, and M. R. Grigor, 1999, National Center for Biology Information, GenBank Accession number AF212146) and humans (Vékony et al., 2001). CAT-2A hybridized to a predominant transcript of expected size (~7.9 kb) in porcine liver but not MT, which is consistent with other studies (Closs et al., 1993) demonstrating, to date, the specificity of CAT-2A for hepatic tissue only. In contrast to CAT-2A, the 400 bp CAT-2B probe hybridized to a single transcript in both liver and MT.
|
Transcript abundance on d 7 and 17 of lactation of AA transporters CAT-1, CAT-2B, B0,+, and ASCT1 was determined by Northern blot analysis using the validated probes as described previously. Figure 2A suggests that B0,+ transcript abundance was lower on d 17 compared with d 7. No apparent change in transcript abundance was observed for CAT-1, CAT-2B, and ASCT1 (data not shown). Absolute quantification of B0,+ mRNA abundance on d 7 and 17 was also determined by real-time PCR. Porcine B0,+ cDNA probe developed for Northern blot analysis was used as a standard template. Mammary tissue RNA from d 7 and 17 was converted into first-strand cDNA, and quantitative real-time RT-PCR was conducted as previously described (Coussens et al., 2003; Madsen et al., 2004) with 50 ng of template cDNA and gene-specific primers designed using Primer Express (PerkinElmer Applied Biosystems). The B0,+ forward primer was 5'GGTGGTCCATTTTGGTCCATAT 3', and reverse primer was 5'GTGATCGTTTCAATCG AAGCAA 3'. ß-actin was used as the control gene in this system with forward primer 5'CTCCTTCCTGGGCAT GGA 3' and reverse primer 5' CGCACTTCATGATCGA GTTGA 3'. Five-point standard curves for B0,+ and ß-actin were run on each plate and determined to be linear and parallel to each other, indicating similar reaction efficiency. All samples were run in triplicate. Three wells per plate had all reagents added except the cDNA template, which served as the negative control. All analyses were conducted using an ABI 7700 DNA sequence detection system (PerkinElmer Applied Biosystems). For each test amplification reaction, mean B0,+ expressions were normalized against ß-actin (within sow and sample day) to account for differences between individual samples in RNA loading, cDNA synthesis efficiency, and amplification efficiency. Differences between means were detected using the MIXED procedure of SAS (1998). Figure 2B demonstrates that B0,+ transcript abundance tended (P = 0.08) to decrease from early to peak lactation in porcine MT.
|
|
FOOTNOTES |
|---|
Received for publication January 17, 2004. Accepted for publication June 29, 2004.
|
REFERENCES |
|---|
|
TOPABSTRACTREFERENCES |
|---|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
